Search results
From WormBaseWiki
Jump to navigationJump to searchCreate the page "PCR product" on this wiki! See also the search results found.
Page title matches
- Overlaps_CDS ?CDS XREF Corresponding_PCR_product // Dan PCR mappings [010419 dl]2 KB (176 words) - 16:09, 4 October 2010
Page text matches
- ...Sample Sample_A UNIQUE ?Condition //for PCR product-base (SMD-type) chips ...Sample_B UNIQUE ?Condition //for PCR product-base (SMD-type) chips892 bytes (72 words) - 14:43, 4 October 2010
- ...: (1). Find coordinates in the genome that can theoretically produce a PCR product given a pair of primer sequences, and (2). Find the smallest encompassing g ...lumns should be separated by one or more blank space. You may not know the product length a priori. Just give a generic number, say 2000, and set the toleranc3 KB (523 words) - 18:34, 17 August 2010
- ...genes (red dots). The proxy for lin-41 in the microarray analysis is a PCR Product: sjj_C12C8.3. You can click on the link and get detailed information.1 KB (190 words) - 18:27, 17 August 2010
- |Gene Ontology (GO): Molecular Function||Annotation of gene product to GO molecular function terms based upon in vitro assays, mutant phenotype |Gene product interactions (physical interactions)||Gene product interactions with other gene products (protein, nucleic acids), some overla9 KB (1,174 words) - 18:30, 29 August 2012
- ...ene?name=otIs11;class=Transgene otIs11]||[zig-5::gfp] promoter fusion. PCR product of the p...||[http://dev.wormbase.org/db/misc/paper?name=WBPaper00006180;cl ...ene?name=otIs12;class=Transgene otIs12]||[zig-5::gfp] promoter fusion. PCR product of the p...||[http://dev.wormbase.org/db/misc/paper?name=WBPaper00006180;cl35 KB (5,125 words) - 17:44, 17 August 2010
- | Molecular function of a gene product||a new/novel molecular function or aspect of molecular function for a gene. | Gene product interactions||physical interactions were demonstrated between protein-prote5 KB (816 words) - 20:11, 7 September 2011
- ...o describe subcellular localization, molecular function, and processes the product involved in *We received PCR products before the final CSHace dump, but some were apparently missing6 KB (944 words) - 16:25, 1 November 2012
- * #794 - PCR page update overlapping gene - JW ** usable, wokring with Chris on final product3 KB (416 words) - 18:30, 24 September 2013
- '''Molecular function of a gene product : ''' A new/novel molecular function or aspect of mol function for a gene '''''Gene product interactions : ''''' Protein-protein, RNA-protein, DNA-protein, or Y2H int12 KB (1,832 words) - 18:43, 11 August 2010
- |elegans||||Molecular function of a gene product ||genefunc||Please indicate if your paper discusses a new function for a kn |elegans||||Gene product interactions ||geneprod||Please indicate if your paper reports data on prot11 KB (1,688 words) - 11:06, 21 December 2011
- *Ideally, curators could submit: PCR product names (e.g. sjj_W02C12.3), raw DNA sequence, primers5 KB (847 words) - 17:49, 1 March 2012
- |||||'''Molecular function of a gene product'''[http://tazendra.caltech.edu/~postgres/cgi-bin/curation_status.cgi?action ...in/curation_status.cgi?action=fc&field=geneproduct (flagged-done)]||''Gene product interaction'' ||geneprod||Check if your paper reports data on protein-prote17 KB (2,417 words) - 11:04, 21 December 2011
- |||||Molecular function of a gene product [http://tazendra.caltech.edu/~postgres/cgi-bin/curation_status.cgi?action=f |||||Gene product interactions [http://tazendra.caltech.edu/~postgres/cgi-bin/curation_status16 KB (2,310 words) - 11:05, 21 December 2011
- | :embl-info/product | Product35 KB (4,174 words) - 10:52, 2 February 2015
- |||||Molecular function of a gene product ||genefunc||Please indicate if your paper discusses a new function for a kn |||||Gene product interactions ||geneprod||Please indicate if your paper reports data on prot13 KB (1,960 words) - 11:07, 21 December 2011
- 20256 sjj PCR product clone10 KB (1,176 words) - 22:24, 18 March 2014
- ...TSL_tag // Indicates a short RT-PCR product for TSL detection [030220 dl]12 KB (1,258 words) - 09:29, 5 October 2010
- ...primers (it's usually good practice to check the primer sequences using e-PCR to confirm that they work properly), genomic coordinates, cDNA/EST/OST clon The "PCR Product", "Primer1", "Primer2", "Genomic Coordinates", "Clone", and "Sequence" colu47 KB (7,989 words) - 23:40, 1 September 2015
- ...cDNAs in Y. Kohara\'sThe unc-97(su110) molecular lesion was identified by PCR amplification of the F14D12.2 gene from unc-97(su110) mutant an imals and s ...uct was very likely not the aythentic initiation codon. The new grd-2 gene product has an extra 78 amino acids in front of the methionine residue that we used40 KB (4,083 words) - 23:02, 13 August 2010
- *PCR Product - rna_pcrproduct - PCR_product - ?PCR_product (Multi-ontology) #Note: EBI/H a) There is at least one "PCR Product" entry OR29 KB (4,152 words) - 20:29, 30 July 2019
- |RT-PCR of embryonic mRNA identified two ulp-2 isoforms; ulp-2a, which is expressed |Rule of thumb for GO - is the gene product '''part of''' the process or does it '''regulate''' the process?16 KB (1,999 words) - 18:24, 28 October 2015
- ...ve // The multiplicative neutrality function defines expectation as the product of two quantified phenotypes (relative to wild type) Also, CDS and Gene, when overlapping, have #Evidence, but the PCR and Sequence do not. Why is this? Does it have to do with needing to indi50 KB (5,228 words) - 15:10, 21 July 2017
- ****Changed these Interaction relationships to "Associated Product" ***Ported and corrected e-PCR tool as well29 KB (4,254 words) - 20:25, 27 April 2012
- ...ge<br> Phenotype<br> Molecule<br> Person<br> Strain<br> Laboratory<br> PCR Product<br> ||/home/postgres/work/citace_upload/rnai/get_rnai_ace.pm<br> (Required20 KB (3,050 words) - 21:01, 19 April 2017
- * gene product(s) ...eparate the two sequences. If you have primers you can use the WormBase e-PCR tool located here." Note: the e-PRC tool link is http://www.wormbase.org/t29 KB (4,575 words) - 16:23, 3 March 2022
- guidelines for gene product localization experiments assessed with reporter gene fusions. ...made using plasmid pPD95.75 as parent vector, and a fusion of a long range PCR fragment of genomic pkd-2 (promoter and 5'-end) with a 3'-end fragment deri21 KB (3,194 words) - 02:08, 17 May 2018
- ...ve // The multiplicative neutrality function defines expectation as the product of two quantified phenotypes (relative to wild type) ...// The multiplicative neutrality function defines expectation as the product of two quantified phenotypes (relative to wild type)235 KB (23,325 words) - 10:33, 3 July 2014
- ...into the GFP plasmid pPD95.85, cut with XmaI and KpnI. The vit-2 gene was PCR amplified with primers V2F (TCCCCCCGGGTCCACGGACATTTCTGGGTCATTTG) and V2R (C ...of the PCR product and the plasmid pAZ132 with SpeI, ligation of the pgl-1 product and the SpeI fragment of pAZ132 bearing unc-119(+) and pie-1::gfp sequences397 KB (64,724 words) - 09:57, 7 July 2020
- ...s, or molecular clones spanning a defined chromosomal interval; electronic PCR; finding expression patterns, and the cell types or developmental origins f ...n available: identity of the gene's product; normal function of the gene's product; orthologs of the gene (if any); the gene's meiotic and physical location w103 KB (16,375 words) - 23:39, 30 November 2010
- | Plasmid: PCR clones ...jj_Y41D4A_2491.a_b ; Oligo: sjj_Y41D4A_2491.a_f) fails to produce an ePCR product and each individually fails to map to the genome when searched with Genome67 KB (10,954 words) - 09:22, 19 February 2013