WS177
From WormBaseWiki
Release Notes
New release of WormBase WS177, Wormpep177 and Wormrna177 Fri Jun 15 15:39:40 BST 2007
WS177 was built by Michael Han
======================================================================
This directory includes:
i) database.WS177.*.tar.gz - compressed data for new release
ii) models.wrm.WS177 - the latest database schema (also in above database files)
iii) CHROMOSOMES/subdir - contains 3 files (DNA, GFF & AGP per chromosome)
iv) WS177-WS176.dbcomp - log file reporting difference from last release
v) wormpep177.tar.gz - full Wormpep distribution corresponding to WS177
vi) wormrna177.tar.gz - latest WormRNA release containing non-coding RNA's in the genome
vii) confirmed_genes.WS177.gz - DNA sequences of all genes confirmed by EST &/or cDNA
viii) cDNA2orf.WS177.gz - Latest set of ORF connections to each cDNA (EST, OST, mRNA)
ix) gene_interpolated_map_positions.WS177.gz - Interpolated map positions for each coding/RNA gene
x) clone_interpolated_map_positions.WS177.gz - Interpolated map positions for each clone
xi) best_blastp_hits.WS177.gz - for each C. elegans WormPep protein, lists Best blastp match to
human, fly, yeast, C. briggsae, and SwissProt & TrEMBL proteins.
xii) best_blastp_hits_brigprot.WS177.gz - for each C. briggsae protein, lists Best blastp match to
human, fly, yeast, C. elegans, and SwissProt & TrEMBL proteins.
xiii) geneIDs.WS177.gz - list of all current gene identifiers with CGC & molecular names (when known)
xiv) PCR_product2gene.WS177.gz - Mappings between PCR products and overlapping Genes
Release notes on the web:
-------------------------
http://www.wormbase.org/wiki/index.php/Release_notes
Genome sequence composition:
----------------------------
WS177 WS176 change
----------------------------------------------
a 32365888 32365889 -1
c 17779856 17779856 +0
g 17756017 17756016 +1
t 32365689 32365689 +0
Total 100267450 100267450
Chromosomal Changes:
--------------------
Chromosome: I
7301405 7301404 0 -> 7301405 7301405 1
9606432 9606431 0 -> 9606433 9606433 1
Chromosome: III
9778413 9778413 1 -> 9778413 9778412 0
9863640 9863639 0 -> 9863639 9863639 1
Chromosome: V
10766209 10766209 1 -> 10766209 10766208 0
Chromosome: X
11848274 11848274 1 -> 11848274 11848273 0
Gene data set (Live C.elegans genes 24123)
------------------------------------------
Molecular_info 22418 (92.9%)
Concise_description 4732 (19.6%)
Reference 7097 (29.4%)
CGC_approved Gene name 9279 (38.5%)
RNAi_result 19875 (82.4%)
Microarray_results 19569 (81.1%)
SAGE_transcript 0 (0%)
Wormpep data set:
----------------------------
There are 20140 CDS in autoace, 23412 when counting 3272 alternate splice forms.
The 23412 sequences contain 10,288,612 base pairs in total.
Modified entries 52
Deleted entries 0
New entries 62
Reappeared entries 2
Net change +64
Status of entries: Confidence level of prediction (based on the amount of transcript evidence)
-------------------------------------------------
Confirmed 8020 (34.3%) Every base of every exon has transcription evidence (mRNA, EST etc.)
Partially_confirmed 10747 (45.9%) Some, but not all exon bases are covered by transcript evidence
Predicted 4645 (19.8%) No transcriptional evidence at all
Status of entries: Protein Accessions
-------------------------------------
UniProtKB/Swiss-Prot accessions 3544 (15.1%)
UniProtKB/TrEMBL accessions 19448 (83.1%)
Status of entries: Protein_ID's in EMBL
---------------------------------------
Protein_id 22992 (98.2%)
Gene <-> CDS,Transcript,Pseudogene connections (cgc-approved)
---------------------------------------------
Entries with CGC-approved Gene name 7641
GeneModel correction progress WS176 -> WS177
-----------------------------------------
Confirmed introns not in a CDS gene model;
+---------+--------+
| Introns | Change |
+---------+--------+
Cambridge | 0 | -70 |
St Louis | 0 | -179 |
+---------+--------+
Members of known repeat families that overlap predicted exons;
+---------+--------+
| Repeats | Change |
+---------+--------+
Cambridge | 0 | -6 |
St Louis | 0 | -6 |
+---------+--------+
Synchronisation with GenBank / EMBL:
------------------------------------
CHROMOSOME_V sequence Z72508
CHROMOSOME_X sequence Z67755
There are no gaps remaining in the genome sequence
---------------
For more info mail help@wormbase.org
-===================================================================================-
New Data:
---------
New orthology data from user submissions was added and curated.
EnsEMBL orthologues from EnsEMBL-compara release 44 were imported to update the ortholog_other EnsEMBL data.
Large increases of Anatomy_term and Anatomy_name have been made in order to clearly distinguish the identity of a cell (e.g. ABalapp) from its nucleus (e.g. ABalapp nucleus).
Transcript alignment data from non C.elegans Caenorhabditis species (C.briggsae / C. brenneri / C.remanei / C.japonica) to the C.elegans genome was added to WormBase.
Genome sequence updates:
-----------------------
7 changes were made to the genome sequence:
F54F7 deletion tagctcaccagcttgcacgGgaagtgaaagtcttgaaata
F28H7 deletion aacaaaatcttgcaactagTaatgtgaaaaagtgtggact
K07A1 insertion ttctcaaatttcagtttatTggaacattacaaatatgtgt
F13G3 insertion tttttttcagacaccgttcgtttggctccgGcgcgatcaacatggtgatggttgcacaagg
R10E11 deletion gccacctggaaatcaatcagctcctcaaaaAgaattccgaatctgcctatattctgttcta
K11H3 insertion gcattaacaacacacggaaatcgaaatggaCcacttcgttatagtcttcttcaacaacgag
Y95D11A shift-overlap GTTATATATTTTTTTGGAAATTTATAACTCTTAAAAAAATTCAATTTTTTCAAATAAATAAAATTTCAGATGGCTTCTCAACCGGAGCTCATAATGGTTG
ACGAGCAAGTCGTCGCTTATGAAGTAGAAATTGATAGTTTTGATGTAAAATATGATGAAGAGGAACATGATGGTCAAGGGACACAAGATGAACCATTTTC
TCATGGTACGGAACAGTTTTACGCTGAAAAATTCCAGAATTCCAAAAAATGAAACCTAAAATAGTGATAAAAAGGCGTTTTGAATATTAAATTGAAGAAA
AAAATCAGCAAAAATTGTTCAAAATCAAGAATTTTAACGGAAAAGTGTAAAATCTTCTCCACGGGGAGTACACATGCTTCGTAAATCGACATATGGTCAA
TTTTAAAGTTTTGAAAATTGAAATGCCGGCAAAAAATCTTTTCTTGTTTTTTTTTCGCAAAAAATTCAATTTTCGAAAAAATAATTATAGAAAATTGCAT
TTTTTGACCGAAAAGTCAATAAAAATAACAGAAAAAATCGATAAACCGTTGAAAAATTTTTTTTTAATTCAAAAATTCAGAAATTCTTAAAATTCAAATT
TCCAGATGAGCCAAGCACCAGCGGTTATCACCATCACTACCAATTTCCCAATGACGTGGATCCAAATGATGTTTATTTATTCGATGAGGTATCAATTATC
CGAAATTTGGCGATTTTTGAGCCAAAACTACGGTACCCGGTCTCGACACGACAATTTTTGTTAAATTAAAAAAGGTGTGCGCCTTTGAAGGTTACTGTAG
TTTCGAACTTTTGCTGATTTTTCATATTTTTTCGTTGAAAACAAAAGTATTTATTTGTTGAAAATCAGAAAATATTATCTTCGCGTCGAGACCTATTACC
ATTCTATTTTTGCCGCAAAAAACAAAATTTCCTTTAAAAAAAAGCTAATTTTTCCAAGTTTTTCCAGGAAACTGATCAAATTCATCAGCTCGACCCGAAT
CAACTCAAAAATAATGAAGAAATTGACGATGTCGAATATATTGATCAATCTGTGCCTTCCACGTCATCAATGATGACGTCACTGCCGTCAACGGTGGCTC
CAGTTCAGCCAAATACGTATTACAGACGGAAATCTGGAGGCCCAACTGCAACTGGAAATGAAAAACCGAATTATAGGCCGTTGGCGTTCCAAACGGTTCG
taaaataaaaaaaatgtccatgtgtcgatt
New Fixes:
----------
Known Problems:
---------------
Other Changes:
--------------
Proposed Changes / Forthcoming Data:
-------------------------------------
Additional genome changes are planned for WS178.
Model Changes:
------------------------------------
-===================================================================================-
Quick installation guide for UNIX/Linux systems
-----------------------------------------------
1. Create a new directory to contain your copy of WormBase,
e.g. /users/yourname/wormbase
2. Unpack and untar all of the database.*.tar.gz files into
this directory. You will need approximately 2-3 Gb of disk space.
3. Obtain and install a suitable acedb binary for your system
(available from www.acedb.org).
4. Use the acedb 'xace' program to open your database, e.g.
type 'xace /users/yourname/wormbase' at the command prompt.
5. See the acedb website for more information about acedb and
using xace.
____________ END _____________
known errors and fixes
missing landmarks
The GFF files for Chromosome II,III,IV,V,X are missing landmark entries. A patchfile for the missing landmark is available at ftp://ftp.sanger.ac.uk/pub2/wormbase/WS177/landmark_patch.gff.gz </nowiki>
