WS177

From WormBaseWiki

Jump to: navigation, search

Release Notes

 New release of WormBase WS177, Wormpep177 and Wormrna177 Fri Jun 15 15:39:40 BST 2007
 
 
 WS177 was built by Michael Han
 ======================================================================
 
 This directory includes:
 i)   database.WS177.*.tar.gz     -   compressed data for new release
 ii)  models.wrm.WS177            -   the latest database schema (also in above database files)
 iii) CHROMOSOMES/subdir          -   contains 3 files (DNA, GFF & AGP per chromosome)
 iv)  WS177-WS176.dbcomp          -   log file reporting difference from last release
 v)   wormpep177.tar.gz           -   full Wormpep distribution corresponding to WS177
 vi)   wormrna177.tar.gz          -   latest WormRNA release containing non-coding RNA's in the genome
 vii)  confirmed_genes.WS177.gz   -   DNA sequences of all genes confirmed by EST &/or cDNA
 viii) cDNA2orf.WS177.gz          -   Latest set of ORF connections to each cDNA (EST, OST, mRNA)
 ix)   gene_interpolated_map_positions.WS177.gz    - Interpolated map positions for each coding/RNA gene
 x)    clone_interpolated_map_positions.WS177.gz   - Interpolated map positions for each clone
 xi)   best_blastp_hits.WS177.gz  - for each C. elegans WormPep protein, lists Best blastp match to
                             human, fly, yeast, C. briggsae, and SwissProt & TrEMBL proteins.
 xii)  best_blastp_hits_brigprot.WS177.gz   - for each C. briggsae protein, lists Best blastp match to
                                      human, fly, yeast, C. elegans, and SwissProt & TrEMBL proteins.
 xiii) geneIDs.WS177.gz   - list of all current gene identifiers with CGC & molecular names (when known)
 xiv)  PCR_product2gene.WS177.gz   - Mappings between PCR products and overlapping Genes
 
 
 Release notes on the web:
 -------------------------
 http://www.wormbase.org/wiki/index.php/Release_notes
 
 
 
 Genome sequence composition:
 ----------------------------
 
        	WS177       	WS176      	change
 ----------------------------------------------
 a    	32365888	32365889	  -1
 c    	17779856	17779856	  +0
 g    	17756017	17756016	  +1
 t    	32365689	32365689	  +0
 
 Total	100267450	100267450
 
 
 Chromosomal Changes:
 --------------------
 
 Chromosome: I
 7301405 7301404 0   ->   7301405 7301405 1
 9606432 9606431 0   ->   9606433 9606433 1
 
 Chromosome: III
 9778413 9778413 1   ->   9778413 9778412 0
 9863640 9863639 0   ->   9863639 9863639 1
 
 Chromosome: V
 10766209 10766209 1   ->   10766209 10766208 0
 
 Chromosome: X
 11848274 11848274 1   ->   11848274 11848273 0
 
 
 Gene data set (Live C.elegans genes 24123)
 ------------------------------------------
 Molecular_info              22418 (92.9%)
 Concise_description          4732 (19.6%)
 Reference                    7097 (29.4%)
 CGC_approved Gene name       9279 (38.5%)
 RNAi_result                 19875 (82.4%)
 Microarray_results          19569 (81.1%)
 SAGE_transcript             0 (0%)
 
 
 
 
 Wormpep data set:
 ----------------------------
 
 There are 20140 CDS in autoace, 23412 when counting 3272 alternate splice forms.
 
 The 23412 sequences contain 10,288,612 base pairs in total.
 
 Modified entries      52
 Deleted entries       0
 New entries           62
 Reappeared entries    2
 
 Net change  +64
 
 
 Status of entries: Confidence level of prediction (based on the amount of transcript evidence)
 -------------------------------------------------
 Confirmed              8020 (34.3%)	Every base of every exon has transcription evidence (mRNA, EST etc.)
 Partially_confirmed   10747 (45.9%)	Some, but not all exon bases are covered by transcript evidence
 Predicted              4645 (19.8%)	No transcriptional evidence at all
 
 
 
 Status of entries: Protein Accessions
 -------------------------------------
 UniProtKB/Swiss-Prot accessions   3544 (15.1%)
 UniProtKB/TrEMBL accessions     19448 (83.1%)
 
 
 
 Status of entries: Protein_ID's in EMBL
 ---------------------------------------
 Protein_id            22992 (98.2%)
 
 
 
 Gene <-> CDS,Transcript,Pseudogene connections (cgc-approved)
 ---------------------------------------------
 Entries with CGC-approved Gene name   7641
 
 
 GeneModel correction progress WS176 -> WS177
 -----------------------------------------
 Confirmed introns not in a CDS gene model;
 
           +---------+--------+
           | Introns | Change |
           +---------+--------+
 Cambridge |      0  |   -70  |
 St Louis  |      0  |  -179  |
           +---------+--------+
 
 
 Members of known repeat families that overlap predicted exons;
 
             +---------+--------+
             | Repeats | Change |
             +---------+--------+
 Cambridge   |      0  |    -6  |
 St Louis    |      0  |    -6  |
             +---------+--------+
 
 
 
 Synchronisation with GenBank / EMBL:
 ------------------------------------
 
 CHROMOSOME_V	sequence Z72508
 CHROMOSOME_X	sequence Z67755
 
 There are no gaps remaining in the genome sequence
 ---------------
 For more info mail help@wormbase.org
 -===================================================================================-
 
 
 
 New Data:
 ---------
 
 New orthology data from user submissions was added and curated.
 
 EnsEMBL orthologues from EnsEMBL-compara release 44 were imported to update the ortholog_other EnsEMBL data.
 
 Large increases of Anatomy_term and Anatomy_name have been made in order to clearly distinguish the identity of a cell (e.g. ABalapp) from its nucleus (e.g. ABalapp nucleus).
 
 Transcript alignment data from non C.elegans Caenorhabditis species (C.briggsae / C. brenneri / C.remanei / C.japonica) to the C.elegans genome was added to WormBase.
 
 Genome sequence updates:
 -----------------------
 
 7 changes were made to the genome sequence:
 
 F54F7   deletion  tagctcaccagcttgcacgGgaagtgaaagtcttgaaata
 F28H7   deletion  aacaaaatcttgcaactagTaatgtgaaaaagtgtggact
 K07A1   insertion ttctcaaatttcagtttatTggaacattacaaatatgtgt
 F13G3   insertion tttttttcagacaccgttcgtttggctccgGcgcgatcaacatggtgatggttgcacaagg
 R10E11  deletion  gccacctggaaatcaatcagctcctcaaaaAgaattccgaatctgcctatattctgttcta
 K11H3   insertion gcattaacaacacacggaaatcgaaatggaCcacttcgttatagtcttcttcaacaacgag
 Y95D11A shift-overlap GTTATATATTTTTTTGGAAATTTATAACTCTTAAAAAAATTCAATTTTTTCAAATAAATAAAATTTCAGATGGCTTCTCAACCGGAGCTCATAATGGTTG
 ACGAGCAAGTCGTCGCTTATGAAGTAGAAATTGATAGTTTTGATGTAAAATATGATGAAGAGGAACATGATGGTCAAGGGACACAAGATGAACCATTTTC
 TCATGGTACGGAACAGTTTTACGCTGAAAAATTCCAGAATTCCAAAAAATGAAACCTAAAATAGTGATAAAAAGGCGTTTTGAATATTAAATTGAAGAAA
 AAAATCAGCAAAAATTGTTCAAAATCAAGAATTTTAACGGAAAAGTGTAAAATCTTCTCCACGGGGAGTACACATGCTTCGTAAATCGACATATGGTCAA
 TTTTAAAGTTTTGAAAATTGAAATGCCGGCAAAAAATCTTTTCTTGTTTTTTTTTCGCAAAAAATTCAATTTTCGAAAAAATAATTATAGAAAATTGCAT
 TTTTTGACCGAAAAGTCAATAAAAATAACAGAAAAAATCGATAAACCGTTGAAAAATTTTTTTTTAATTCAAAAATTCAGAAATTCTTAAAATTCAAATT
 TCCAGATGAGCCAAGCACCAGCGGTTATCACCATCACTACCAATTTCCCAATGACGTGGATCCAAATGATGTTTATTTATTCGATGAGGTATCAATTATC
 CGAAATTTGGCGATTTTTGAGCCAAAACTACGGTACCCGGTCTCGACACGACAATTTTTGTTAAATTAAAAAAGGTGTGCGCCTTTGAAGGTTACTGTAG
 TTTCGAACTTTTGCTGATTTTTCATATTTTTTCGTTGAAAACAAAAGTATTTATTTGTTGAAAATCAGAAAATATTATCTTCGCGTCGAGACCTATTACC
 ATTCTATTTTTGCCGCAAAAAACAAAATTTCCTTTAAAAAAAAGCTAATTTTTCCAAGTTTTTCCAGGAAACTGATCAAATTCATCAGCTCGACCCGAAT
 CAACTCAAAAATAATGAAGAAATTGACGATGTCGAATATATTGATCAATCTGTGCCTTCCACGTCATCAATGATGACGTCACTGCCGTCAACGGTGGCTC
 CAGTTCAGCCAAATACGTATTACAGACGGAAATCTGGAGGCCCAACTGCAACTGGAAATGAAAAACCGAATTATAGGCCGTTGGCGTTCCAAACGGTTCG
 taaaataaaaaaaatgtccatgtgtcgatt
 
 New Fixes:
 ----------
 
 
 Known Problems:
 ---------------
 
 
 Other Changes:
 --------------
 
 Proposed Changes / Forthcoming Data:
 -------------------------------------
 
 Additional genome changes are planned for WS178.
 
 
 Model Changes:
 ------------------------------------
 
 
 -===================================================================================-
 
 
 Quick installation guide for UNIX/Linux systems
 -----------------------------------------------
 
 1. Create a new directory to contain your copy of WormBase,
 	e.g. /users/yourname/wormbase
 
 2. Unpack and untar all of the database.*.tar.gz files into
 	this directory. You will need approximately 2-3 Gb of disk space.
 
 3. Obtain and install a suitable acedb binary for your system
 	(available from www.acedb.org).
 
 4. Use the acedb 'xace' program to open your database, e.g.
 	type 'xace /users/yourname/wormbase' at the command prompt.
 
 5. See the acedb website for more information about acedb and
 	using xace.
 
 ____________  END _____________
 

known errors and fixes

missing landmarks

The GFF files for Chromosome II,III,IV,V,X are missing landmark entries. A patchfile for the missing landmark is available at ftp://ftp.sanger.ac.uk/pub2/wormbase/WS177/landmark_patch.gff.gz </nowiki>

Personal tools