Mapped Transgenes

From WormBaseWiki
Jump to: navigation, search

WormBase Release WS199

464 integrated transgenes with map information found (download Excel file)

Transgene Transgene_summary Reporter Strain Map_position Expression_pattern Gene Anatomy_term Life_stage Reference
WBPaper00005807Is1 [sur-5::gfp] GFP CU217 I
WBPaper00028359Is1 [shl-1::shl-1(W363F)-GFP] GFP X
WBPaper00028359Is2 [shl-1::shl-1(W363F)-GFP] GFP IV
akIs7 [nmr-1::gfp] GFP V
akIs9 [glr-1::GLR-1(A/T)] X
arIs100 [dpy-7::2Xnls-yfp] YFP II
arIs12 [lin-12(intra)]. Expresses the intracellular domain of LIN-12 under the control of lin-12 promoter. Marked with rol-6(su1006). I
arIs37 [pmyo-3::ssGFP] GFP GS1912
GS2477
GS2478
GS2479
GS2484
GS2495
GS2526
GS2527
GS2532
GS2555
GS2643
LW557
LW614
LW1288
GS1919
I
arIs39 [myo-3::secreted gfp] GFP PD3011
GS2077
X
arIs51 [cdh-3::gfp] GFP GS3754 IV
arIs99 [dpy-7p::2Xnls::yfp] YFP X
axIs36 [pes-10::gfp] GFP JH103 X
ayIs2 [egl-15::gfp] GFP NH2447
PD4285
IV
ayIs26 [Phsp16-2::let-756 (50 ng/ul); Pmyo-2::GFP (5 ng/ul)] GFP III
ayIs29 [egl-15(+) (5 ng/ul); Pmyo-2::GFP (5 ng/ul); pGEM5Z (70 ng/ul)] GFP IV Expr8096 egl-15 hypodermis WBPaper00031854
ayIs4 [egl-17::gfp]. Integrated transgenic line of the egl-17 promoter fused to GFP. GFP NH2246
PS3082
PS2674
PS2580
NH2466
PS5423
PS2987
PS5106
I Expr630 egl-17 proct
PChL
PChR
proct
spicule socket cell
adult
L3 larva
L4 larva
WBPaper00003579
ayIs4 [egl-17::gfp]. Integrated transgenic line of the egl-17 promoter fused to GFP. GFP NH2246
PS3082
PS2674
PS2580
NH2466
PS5423
PS2987
PS5106
I Expr1434 egl-17 P6.ppp
P6.paa
hyp7
P7.ppa
vulB2
P5.ppa
P6.pa
P7.pp
vulE
hyp7
P3.p
P6.ppa
vulB1
P7.ppp
P5.pap
P5.paa
P6.pp
hyp7
hyp7
P6.pap
P7.p
hypodermis
P4.p
P5.pp
head
M4
P7.pa
P6.p
P5.p
vulF
vulval cell
P8.p
vulC
P5.pa
hyp7
vulval cell
P7.pap
vulA
vulD
hyp7
postembryonic
3-fold embryo
fully-elongated embryo
WBPaper00003045
ayIs4 [egl-17::gfp]. Integrated transgenic line of the egl-17 promoter fused to GFP. GFP NH2246
PS3082
PS2674
PS2580
NH2466
PS5423
PS2987
PS5106
I Expr2354 egl-17 vulE
vulF
vulC
vulD
L3 larva
L4 larva
WBPaper00013312
ayIs6 [hlh-8::gfp] GFP PD4666 X Expr8096 egl-15 hypodermis WBPaper00031854
ayIs7 [hlh-8::gfp] GFP PD4667
RG174
IV Marker68 hlh-8 M WBPaper00032077
ayIs9 [egl-17::gfp] GFP NH646 V Expr1814 egl-17 dorsal uterine cell adult
L4 larva
WBPaper00004362
bIs1 [vit-2::gfp; rol-6(su1006)]. The plasmid V2B3 encodes a functional VIT-2(YP170B)::GFP fusion protein expressed under vit-2 promoter control. The plasmid was made by ligating a PCR product encoding vit-2 genomic sequences, including 1 kb of promoter and the complete gene lacking a stop codon, into the GFP plasmid pPD95.85, cut with XmaI and KpnI. The vit-2 gene was PCR amplified with primers V2F (TCCCCCCGGGTCCACGGACATTTCTGGGTCATTTG) and V2R (CGGGGTACCAGATAAGCGACGCAGGCGGTTGGGAC), containing engineered XmaI and KpnI sites, using cosmid DNA (C42D8) as a template. V2B3, at 50 ug/ml, was coinjected with rol-6(d) marker pRF4, at 100 ug/ml, into N2 to make transformed lines using standard methods. Four integrated lines (bIs1bIs4) were produced by standard methods. GFP DH1033
DH1006
X
bcIs1 [egl-1::gfp] GFP III
bcIs24 [tph-1::gfp] GFP X
bcIs25 [tph-1::gfp] GFP IV
bcIs30 [tph-1::gfp] GFP X
bcIs37 [egl-1::his24-gfp] GFP V
bcIs39 [lim-7::ced-1-gfp] GFP MD701 V
bnIs1 [pie-1::gfp-pgl-1, unc-119(+)]. Constructed by amplification of a 2.2 kb segment of pgl-1 cDNA with the primers 5'-GGACTAGTATGGAGGCTAACAAGCG-3' and 5'-CCACTAGTTTAGAAACCTCCGCGTCC-3', digestion of the PCR product and the plasmid pAZ132 with SpeI, ligation of the pgl-1 product and the SpeI fragment of pAZ132 bearing unc-119(+) and pie-1::gfp sequences, and bombardment of the ligated DNA into unc-119(ed3) worms. GFP SS747
SS629
I
bpIs56 [alg-1::dsRed] DsRed II
bxIs13 [egl-5::gfp, lin-15] GFP EM599
HZ107
HZ113
X
bxIs14 [pkd-2::gfp, pha-1] GFP EM886
EM902
EM905
EM907
EM908
EM909
EM911
V
bxIs16 [tph-1::gfp (EM#310), cat-2::yfp (EM#303), pBX-1] GFP HZ66
HZ67
V
bzIs3 [mec-4::lacZ]. Contains ~10 copies of mec-4(u231) allele and several copies of mec-4::lacZ fusion TU#44. LacZ ZB7 X
bzIs67 [mec-10::mec-10(d)-GFP pRF4] GFP ZB2356 X
bzIs7 [mec-4::gfp] GFP ZB171 IV
bzIs75 [mec-4::mec-10(d)-GFP unc-119(+)] GFP ZB2374 IV
ccIs4251 [myo-3::Ngfp-lacZ; myo-3::Mtgfp] GFP CB5600
HC75
HC114
HC271
PD4251
PD6249
I Marker38 myo-3 muscle cell WBPaper00031556
ccIs4438 [hlh-8::gfp] GFP IV
ccIs4439 [intrinsic CC::gfp] GFP PD4439 III
ccIs4443 [arg-1::gfp] GFP PD4443 IV
ccIs4444 [arg-1::gfp; dpy-20(+)] GFP PD4444 II Expr4734 arg-1 vulval muscle
anal depressor muscle
hmc
intestinal muscle
anal sphincter muscle
WBPaper00029191
ccIs4595 [ceh-24::gfp] GFP PD4595 V
ccIs4636 [hlh-8::lacZ] LacZ PD4636 V
ccIs4655 [Nde-box::gfp] GFP PD4655 II
ccIs4656 [NdE-box::gfp] GFP PD4656 IV
ccIs4810 [lmn-1::gfp]. A fusion of GFP to the C-terminus of Ce-lamin. GFP YG1021
LW0697
X Expr956 lmn-1 Cell all stages WBPaper00004416
ccIs4810 [lmn-1::gfp]. A fusion of GFP to the C-terminus of Ce-lamin. GFP YG1021
LW0697
X Marker9 lmn-1 WBPaper00026936
ccIs4811 [lmn-1::lmn-1-gfp-lmn-1 3UTR; pMH86(dpy-20(+)] GFP LW0698 X Marker9 lmn-1 WBPaper00026936
ccIs4812 [lmn-1::lmn-1-gfp-lmn-1 3UTR; pMH86(dpy-20(+)] GFP LW0700 X Marker9 lmn-1 WBPaper00026936
ccIs55 [sup-7(st5)unc-54::LacZ] LacZ PD55
PJ1002
PJ1015
PJ1034
PJ1036
PJ1039
PJ1044
PJ1046
PJ1062
PJ1063
PJ1065
PJ1069
PJ1070
PJ1076
PJ1078
PJ1080
PJ1085
PJ1092
PJ1093
PJ1099
PJ1100
PJ1105
PJ1107
PJ1109
PJ1110
PJ1114
PJ1115
PJ1121
PJ1124
PJ1126
PJ1132
PJ1134
PJ1145
PJ1146
PJ1153
PJ1154
PJ1155
PJ1156
PJ1158
PJ1162
PJ1166
V
ccIs7963 [hlh-1::gfp] GFP V
ccIs9753 PD9753 I
cdIs5 [myo-3::DsRed2] DsRed2 I
cgc3903Is1 [tph-1::gfp]. A DNA fragment encompassing the 3.1 kb tph-1 5' regulatory sequence and introns and exons to the beginning of exon 4, was PCR amplied using primers containing restriction sites, ligated to the GFP cassette pPD95.75. GFP GR1333 V Expr959 tph-1 HSNR
ADFR
NSMR
AIML
NSML
AIMR
CP neuron
RIH
ADFL
HSNL
L1 larva
adult
WBPaper00003903
cgc5080Is2 [rgs-2::gfp] GFP LX354 IV
cgc5924Is1 [tph-1::gfp; rol-6(su1006)] GFP V
cgc6572Is1 [pie-1::gfp-spd-2] translational fusion. GFP TH42 II Expr2995 spd-2 WBPaper00013494
cgc6998Is1 [kin-29::gfp] GFP PY3018 IV
cgc7137Is1 [elt-2::gfp-LacZ] GFP X
chIs1200 [ceh-26::gfp] translational fusion. GFP TB1225 III Expr2696 ceh-26 HOB L4 larva
adult male
WBPaper00006247
cmIs6 [mbk-1::gfp] translational fusion. The mbk-1 genomic locus, including 7 kb of 5' noncoding sequence and all exons and introns, was amplified by Expand long-template PCR. The PCR product was cloned in frame with gfp in the promoterless vector pPD95.75, generating pBR104. GFP EK224 I Expr2387 mbk-1 Cell L1 larva
adult
L2 larva
L3 larva
L4 larva
fully-elongated embryo
elongating embryo
gastrulating embryo
enclosing embryo
WBPaper00005756
ctIs1 [her-1::lacZ]. The construct is also known as P2::lacZ. P2 refers to the 3.4 kb of DNA upstream of her-1 exon-3. LacZ I
ctIs40 [ZC421(+); sur-5::gfp]. Overexprss cosmid ZC421 which contains gene dbl-1. sur-5::gfp is used as injection marker. GFP BW1940 X
ctIs43 [unc-119(+); dbl-1::gfp+NLS; dbl-1::gfp-NLS] GFP BW1935
BW1946
V Expr626 dbl-1 M5
M1
VB10
VB7
CANL
VA8
DB5
VA12
VB9
DA5
AVKL
VB8
VA6
VB3
SPso3L
DB7
DVA
DB6
SPso2R
DB4
I5
VA4
VB5
pm2R
VA10
VB11
VA7
VB6
VA11
SPso3R
DB2
DA6
M4
SPso2L
DA7
CANR
SPso4L
SPso1R
AVKR
VA5
VB1
VA2
pm2L
pharyngeal neuron
ventral nerve cord
DB1
DA4
VB2
dorsal nerve cord
DB3
SPso1L
DA3
VA9
SPso4R
VB4
PDB
embryo
L1 larva
adult
L2 larva
L3 larva
L4 larva
WBPaper00003401
cuIs2 [myo-2 C183::gfp]. Integrated expression line for myo-2 enhancer C subelement C183::gfp. GFP OK39
OK66
OK68
OK0039
IV
cuIs22 [ceh-22::gfp] GFP OK0507 III
cuIs5 [myo-2 C183::gfp]. Integrated expression line for myo-2 enhancer C subelement C183::gfp. GFP I
dhIs26 [daf-12A::gfp; lin15(+)] GFP AA120 I
dtIs372 [his-24::his-24-gfp] GFP X
dvIs19 [K08F4.7(727bp):GFP-NLS] GFP CL2166 III Expr8083 gst-4 body wall musculature WBPaper00031223
eIs24 [vab-7::lacZ] LacZ II Expr93 vab-7 Capp
Cppp
Caap
Cpap
embryo
L1 larva
WBPaper00002462
eIs25 [fox-1(gf); rol-6(su1006)]. Contains extrachromosomal copies of R04B3, a cosmid containing fox-1 genomic region. V
eIs26 [fox-1(gf); rol-6(su1006)]. Contains extrachromosomal copies of R04B3, a cosmid containing fox-1 genomic region. IV
eIs27 [fox-1(gf); rol-6(su1006)]. Contains extrachromosomal copies of R04B3, a cosmid containing fox-1 genomic region. V
[unc-31::lacZ;class=Transgene eIs[unc-31::lacZ]] [unc-31::lacZ], in-frame fusion, consists of 15 kb 5' upstream sequence and most of the coding regions of unc-31. LacZ V
edIs6 [unc-119::gfp] GFP DP132 IV Marker39 unc-119 neuron WBPaper00031556
enIs18 [lim-7::mfg-e8-gfp] GFP X
enIs2 GFP X
enIs7 [ced-1::ced-1-GFP; unc-76(+)] GFP X Marker40 ced-1 engulfing cell WBPaper00031556
etIs1 [ric-19::gfp] GFP QC5 IV
etIs2 [ric-19::gfp] GFP QC47
QC101
QC102
QC103
QC104
QC105
III
evIs130A [mec-7::UNC-40-GFP] GFP NW1509 II
evIs138 [plx-2(+); sur-5::gfp] GFP NW1696 V
evIs54 [unc-5B::lacZ] LacZ II
evIs98 [unc-5::GFP; dpy-20(+)] GFP V
evIs99 [emb-9::unc-5; emb-9::lacZ; dpy-20(+)] LacZ I
ezIs1 [K09C8.2::gfp, pRF4] GFP DZ224 X
ezIs10 [lin-32::gfp] GFP DZ390 II
ezIs2 [fkh-6(pro)::gfp, unc-119(+)] transcriptional fusion. GFP DZ325 III Expr2972 fkh-6 gonad
spermatheca
Z1
Z4
L1 larva
adult
L2 larva
L3 larva
L4 larva
WBPaper00006485
gaIs27 [let-23::gfp; rol-6(su1006d)] GFP I
gaIs36 [hs-mpk-1(+); EF1alpha-D-mek(gf); unc-30(+)] V
gmIs12 [srb-6::gfp] GFP III Expr3411 srb-6 PHBL
PHBR
PHAL
PHAR
WBPaper00026633
gmIs13 [srb-6::gfp; rol-6] GFP II
gmIs18 [ceh-23::gfp] GFP X
gmIs20 [hlh-14::gfp] translational fusion. GFP II Expr2897 hlh-14 ABplapppapp
Caapa
ABprapppapa
ABprapppaa
ABprapppa
ABplapppa
ABprapppap
PVQL
ABprapppaap
ABprapppapp
ABplapppap
ABplapppaa
ABplapppaap
PVQR
ABplapppapa
proliferating embryo WBPaper00006354
gmIs20 [hlh-14::gfp] translational fusion. GFP II Expr8261 egl-5 HSNR
HSNL
WBPaper00031910
gmIs21 [nlp-1::gfp] GFP II
gmIs22 [nlp-1::gfp] GFP V
gmIs5 [ina-1::gfp], the ina-1-GFP fusion construct extended from a SmaI site (31302) to a SphI site (16376) surrounding the ina-1 coding region (2354519169), and preserved all introns of the gene. GFP NG2517 III Expr1998 ina-1 pm4VR
ABplppppap
ABprapappppp
ABaraaaap
ABarapapaaa
V3L
Capaapp
ABarappppa
Cppppaa
ABalpappp
ABalpaap
ABplapapaa
Dpaaa
ILsoDR
Dppp
MSpappppp
mc1DR
ABarppapa
MSpaapaap
Cappaa
ABprpaapa
URYDL
g2R
MSapppap
ABplppp
DA6
MSaaappa
ABarpppa
ABarpapapa
ABplapapppa
Caappd
MSpaaaaap
MSaapap
ILsoDL
ADER
ABalppaaa
ABarappaa
ABprapapa
ABplppaapp
ADLR
Y
IL1DR
AINL
ABprppaaaa
HSNR
anal depressor muscle
MSppaaa
ABprppaapa
ABprpp
AVAL
ABarppaa
int7R
Cppapaa
ABalpppa
arc ant DL
ABpraa
ABplaapa
Capap
ABaraapppaa
OLLL
Cpppaap
ILshDL
int5R
MSappa
MSapaapa
ABalaapppap
ABalpaaapa
ABaraaaapp
AUAR
ABprppapap
MSaaaaa
ABplppaapa
SAAVR
AIBL
ABalpaaapap
arc ant DR
ABalaaaarra
P6
ABplpppa
SIBDL
ABarapapa
ABplppppa
DA9
int1DL
IL2L
ABpraaaapa
Daapp
ABplaapapa
ABaraappaa
ABalppppppp
Capa
hyp1
Epl
SIBDR
uterus
ABprpaaaa
MSaaapp
ABalapppapa
PVCL
ABarapapaa
MSpappppa
MSaaa
rect_D
ABarpapap
SMDDL
ASIR
ABplaaaaapa
Dppaa
AVDL
Ea
ABplaaaap
ABarappp
pm2VL
ABprappaap
ABalpppaapv
ABplpapa
ABplaapaaa
Cpp
ABplpaaapa
ABalapaap
ABaraapapa
mu_int_L
RIAL
ABarpapp
MSpap
H1R
ABarpppapp
Daaa
RICR
ABprapaapp
ABprapapap
e2DL
RMER
ABalaapapp
V5R
IL1VR
ABprapaaa
m3R
ABpraaaappa
Dappa
ABarapap
I3
excretory cell
ABarppaap
P8
MSapapap
Eplpp
ABalapaappa
ABplppaap
ABprppp
MSappap
mc2V
ABplaaaa
ABarappap
CANR
ABarpaapa
ABalpaapaa
ABalappaap
ABalpaapa
AVAR
ABaraapppp
MSapaaa
Cpa
PHAR
AWBR
ABalapaapa
ABprpaaapp
ABplaapappp
ABalpapapp
MSappppa
pm8
int1DR
ABarppap
Cppaapp
ABplapppapp
CEPshVL
vpi1
ABplpppaa
ABpraaappa
DA5
MSapaap
ABarapapaapp
MSaaaaapa
Capppaa
ABalapppa
ABpraaappp
ABarapppppa
Cpppapp
MSaapp
OLQshVR
ABarpaaaa
Capappa
MSapppa
ABprpaapaa
ABalppppaa
MSppaaaa
H0L
MSpppap
MSappppp
ABprpaaaaa
ABalappaapp
ABarpapaa
ABplapp
ABalppaapp
Dappap
DD3
ABarppaapp
MSpaaaa
Cpppaa
CANL
int7L
ABalapapa
ABaraaaaa
MSpapaap
MSap
CEPVR
ABplaaapap
URBL
ABarappapap
ABalpapp
ABplapaap
MSppappp
ABpraaaaap
RIAR
ABalaaappl
ABalaaapplr
Cpappd
ABplaaaaapp
ABaraaappp
ccPR
ABaraaapap
MSppaa
Dpp
Dapppa
ABplpaaap
DVC
ABarppppp
Z4
PVR
Cpppppv
Cpaapa
ABalapppapap
ADLL
ABprapp
ABarppppa
ABplpap
B
MSppaaap
RMDR
V6R
ABalaaaal
Dpppp
GLRR
ABalaa
ABprappp
ILshDR
int3D
OLQVR
ASGL
ALA
MSpapaapa
MSaaaa
Cppa
ABarapppp
ABalpa
ABplaaapa
Cpaaa
ABplpappaa
I5
vpi3D
pm1L
MSpppaa
MSppaap
Dpaap
AWAL
ABplpa
Cppppa
Capaap
MSaaaapa
e2DR
MSpppaaa
ABprappapp
ABalppaaaa
ABplppppaa
Da
GLRDL
ADEL
ABaraappp
ccPL
ABprappaa
QL.p
ABalpppapp
ABplpaapppp
MSaaap
SAAVL
Dppppp
RIBR
DB5
Capapp
IL2DR
PVT
ASKL
mc1V
ABarpaaa
MSaaaaaa
ABplaaap
ABalpapap
ABpraapapppp
mc2DL
ADAL
ABpraaaappp
MSapappp
Eal
ABprppppa
MSpp
OLLsoR
MCL
ABprppppppp
AMshL
MSaapaapap
ABalpppappp
URADR
ABprpaappppp
ABplpapaap
ABplpapapa
ABplapppaap
V1L
pm5VL
SIAVR
SABVR
ABarapappa
ABplpapppp
ABprapaaaa
U
ABpraapaaa
ABpraaaapppp
ABalpppapa
ABalapappaap
ABplpaaappa
Dapa
ABplpaapap
ABalapaapap
ABprapaaaaa
DD1
RMDL
ABarpapaapp
OLQsoDR
pm5VR
ABplapaaap
Psub4
MSpppppa
MSpappaa
AWCR
GLRL
Capppp
OLQDL
FLPR
vpi2DR
ABalaappaa
D
RMGL
ABprpppp
MSaapapa
ABprppapp
ABplpaaa
ASJL
ABplpppapa
ABplapapppp
ABpraapap
ABprpappap
ABalapap
ABplpppaap
AVJL
ABalppa
ABplaappa
ABalaapppp
excretory gland cell
Capppa
DD2
AVKL
P11
K
Capaaa
ABplapaaaa
MSppp
MSpaapaa
AIYL
P1
MSpaapap
ABplapappp
virR
Z1
QL.pa
ABprppapaa
ABprapappp
ABprapaaaap
ABprpapaa
g1P
ABalaapaa
vpi2V
MSaapaap
ABplpaappp
MSaapa
ABaraap
MSaappp
ABprpaapppp
ABplpaaaap
MSpapa
ILshVR
ABplaapp
male-specific
ABpraapa
Caaapa
ABprpa
spike
ABalpaaaap
RIPL
Cpaaap
ABalaap
MSaaaap
DD6
ABalappp
ABplapaapp
AVBL
int9R
ABpraappp
ABaraaapa
ABplpppppp
AMshR
ABalppppp
ABalpaaaa
ABaraaapp
ABpraaapapap
Ep
ABprpaaappa
ABarpaappa
IL1DL
QR.pp
arc post V
ABalppaap
Dpppaa
ADFL
SMBDR
vulC
ABplapppaa
Cppap
ABplpaapa
PLMR
G2
head neuron
W
DB3
ABalapappa
ABprppaapaa
SIAVL
Epra
ABprppaap
Cppp
Cppapap
ABprpaapp
RIGL
ABalpapppp
ABalapppp
ALMR
MSaappa
URAVL
ABpraaapap
ABalppapaa
pm7VR
ABplpappp
ABalapaa
MSppppp
ABplappa
ABplapappppp
ABalaapaapa
Cpap
ABalapapaa
ABplaaaaa
ALNL
ABprappaaa
RMED
MSpappa
MSapppp
AIMR
P10
pm1VR
ABalapa
ABalaapaaal
ABplpapaaa
ABarappaapp
ABarapppaa
int4V
ABalaaaalpa
ventral nerve cord
ABalpapapa
ABpraapppa
ABalpp
Capaa
ABalaappap
Cpppa
ABalppappa
MSppapap
MSpaaap
pm5DR
RIGR
MSaapapp
M1
OLQVL
OLLshR
ABplpaaaaa
MSaapppap
DA8
Caa
hmc
ABprapppapa
pm6VL
ABarpapaapa
ABaraaaaap
pm3R
ABplaaaaaap
MSpa
Dpa
ABprpaapap
ABarppp
Cpppppd
MSapappa
ABalppppapa
MSpapap
RIPR
ABpraaaaapv
ABplaapapppp
ABarappapapa
ABprpaappp
Ear
CEMVL
ABprapppapp
MSppappa
ABalappaa
m3L
ABarpapaaap
mc3DL
ABplpapap
Cppapp
Capappp
pm5R
M5
ABprapap
Cappaaa
ABprappppa
AVL
MSppaapa
ABalapaaaap
ABarapapap
MSpaap
g2L
ABarappa
Dpapp
DB7
ABplaapaap
ABarpap
ABprapapaa
ABarapaapap
ABplaappp
ABprppppaa
ABprpaap
ABpraaap
int5L
ABalaappppa
MSapaa
ccAR
ABprapppaap
ABaraaaapaa
MSapa
SMDVL
ABprpaaaap
ABalppappp
Dap
Caaapp
ABalaaaalar
ABalaappa
ABplaapapp
ABarappapp
ABplapap
IL1VL
Cappapp
IL2VR
SIBVR
Cppapa
ADAR
ABarpaa
ABplapaaa
ABalappap
arc post D
ABalpppppp
m2R
e3VL
ABprpaaappap
ABplpaaappap
ABplappapp
XXXR
P3
ASHR
QR.p
ABplaapaaaa
ABprppappa
ABarppapp
ABalaappp
ABplppapa
ABprpapp
ABprpappaa
ABalppppap
ABpraap
GLRVL
int6R
ABarpapaaa
ABprpapa
Capapaa
pm2DR
ABpraaapapp
ABprap
ABpraapapa
ABprppa
ABprapaaap
Caaap
ALNR
H1L
BDUL
mc3DR
int9L
Ealaa
ABalpappaap
e1VR
BAGL
ASEL
ABalpapa
ABalaaappr
RMEL
AIBR
MSpapppp
ABprppaaap
ABplppaaaa
MSappapp
SAADL
ABaraaap
Cappa
ABalppppppa
Cpapaa
pm3DR
ABplapppa
ABaraaaaaa
pm7D
ABalapaaap
pm4R
MSaaapa
DB2
pm1DL
ABarpaaapp
ABprppppp
DA7
ABplppaa
pm3VR
PVCR
CEPshDR
ABpraaa
TR
URYVL
ABarpapa
ABaraaaapa
ABalaapaap
DD4
ABprpapppp
Cappap
arc post DL
ABprpaaapa
MSpapaapap
ABalapapp
ABalppaa
ABplpaapp
ABplpaap
int6L
vulA
MSpaaaap
ABarppa
ABprapaaapa
QL.a
AWCL
ABprppaaaapa
Cpppap
ABalaapaaa
e1D
ABaraaappa
ABplpaaaa
arc post VR
int1VL
RIBL
ABalpppp
ABalappa
ABpraappa
MSaa
ABalpappaaa
ABprpppaa
ABpraaapa
Cpaa
ABprapappppa
MSpapapp
RIS
ABplapppp
ABplpaappppp
MSapppaa
AIZR
ABprpappa
mu_int_R
ABarappaap
Cppaap
URBR
Capapap
ABalpappaapp
ABalpapaapp
QL.aa
ABalppppppap
MSaaaapp
AVER
int1VR
ABarpaappp
ABplppappp
ABprpppppaa
MSaappppa
SIADL
MSappapa
ABplppaapaa
RICL
Daaap
ABplppapap
ABalappppp
ABprapppaa
RIFL
pm4VL
Cpppp
MSppppaa
IL1R
ABarapaaa
ABarapaapa
ABplapaaapa
ABprppaaa
ABpraaaa
DD5
ABarapaaaa
mc2DR
SABVL
ABaraapapaa
V6L
PHAL
I2L
vulF
OLLsoL
ABarpaaaap
MSpppppp
ABplppappa
MSppa
TL
ABarap
ABalaaap
ABplaapppa
ABalaaapa
AFDL
ABalpapapap
QR.aa
ABarppaapa
rect_VL
Dapppp
ABprpppap
ILsoL
QR
ABalaapapa
Dp
ABaraapp
MSpaapp
ABprpappp
URYVR
ABalappppaap
Cppappa
ABalpaaa
I1L
ABalpapaaa
ABplaappaa
OLQshVL
MSppppa
AMsoR
ABalaaaarr
ABalapp
ABarpppaa
ABplppap
Cppaa
Dpppa
ABplaa
ABplapppap
CEPDR
ABplppapaa
int8R
ABprapapppp
CEPsoDL
V5L
ILshVL
IL2R
ABplpp
OLQsoVR
DA2
OLQshDL
MSapaaap
ABplppapaaa
MSpappap
Daaaa
MSpaaapa
ABalpaappp
P5
ABpraaapppa
Dppppa
ABalpppap
ABplappaap
mc3V
ABarappppp
ABprapapp
MI
ABalap
ABarapapp
e2V
ABprpapppa
SMDDR
PHBR
Ealp
PVQL
ABplpapppa
ABplappp
arc ant V
ABplappaaa
AUAL
OLLR
AIAR
g1AL
ABplapaa
Cppaaap
pm5L
Dapaa
ABplaap
ABarapaapp
ABalaaaarla
ABalppap
ABprpapap
pm1DR
ABpraaapppp
PHshL
ABplaapap
ABplaaaapa
ABalpaa
DA1
AINR
ABprpaappa
MSpaapa
ABplppaaaapa
ABpraaaaa
Cpapp
ABaraapapp
RIFR
MSpapapa
ABplappap
Caaa
MSpapppa
GLRDR
PVPR
Eprp
ABarapa
ABalapaaaa
MSpapaa
Dappaa
vpi3V
F
ABprpaaa
AVHL
pm1R
ABplpppppa
ABalaapap
ABarapaaap
I2R
g1AR
AVDR
pm2VR
SAADR
Capaaap
ABalaaaparl
H2L
Cpaapp
RMDDL
ABplaapppp
Cppaaaa
AFDR
CEPsoVL
MSppapa
ABpraaapp
ABplaapaa
ABalaaaar
ASGR
Caapp
ASKR
ABplpppapp
H2R
ABarpapapp
ABarpapaap
Cappapa
ABalpppaap
ILsoVR
V1R
ABarpaapaa
ABpraaaapp
DB6
ABpraaapapa
PHBL
Earaa
P7
ABaraaa
ABalppp
Cpppaaa
ABpraapp
RIR
ABaraappap
ALML
ABprpppaap
ABarpaaap
MSpapapap
ABplpappa
ABarapaaapp
ABalpaapp
MSppapp
K'
SIADR
MSpapaaa
ABprpaa
ABalpappap
Cpaaaa
ABaraapaap
MSaap
Caapa
ABalpaaapp
ABarappaaa
Dpapa
ABplaaapp
NSMR
MSpapp
MSpaaa
XXXL
ABplaaa
AIAL
ABalapaappap
ABpraaapaav
MSpaaaaa
CEPVL
ABalappppa
ABarpppp
ABprpppapp
ASJR
ABalaapppa
ABalpppappa
e3VR
ABprapaap
ABprappa
H0R
URXR
rect_VR
ABalapaapp
QL
ABplpapp
MSpppp
Epla
AVG
OLQsoDL
MSapap
ABalpaaappa
ABpraapaaaa
ABpraaaaaa
CEPshVR
ABplaaaaap
ABaraapaa
Earp
ADEshL
ABplppapp
ABalapapapa
vulE
MSppapaa
ABalaaaala
ABprppap
SMBVR
ABalppapap
Cpapa
ABpraapppp
P2
AIZL
ABalaaaa
Daa
MSpaaapp
ABplapapp
ABprppppap
ABalppaappa
RIMR
V4R
Z3
ABalapppaa
Cppaapa
ABarpaapap
ccAL
MSapapaa
ABplpaa
ABalpaaaaa
ABalppppaav
int2D
ABalppppapp
ABprppapaaa
ABprppaapp
ILshL
ABarapp
I4
ABaraapa
MSaaapap
ABarapaap
IL2DL
ABarpaapp
ABprpaaap
Cappaap
ABplpappap
Cppappp
DVA
MSaapppa
I6
Dpaa
pm2R
ABprapppap
ABarpappap
Dpap
ABalaappppap
pm1VL
V2L
ABprpapapp
ABpraapaa
RID
P12
ABarappapa
ABprpppaapa
SMBVL
vulD
ABalpppaaa
MSpppapp
ABpraaapppap
ABplpppaaa
MSpppa
ADFR
Dappp
ABalpppapppp
Caap
ABprpapapa
pm4DR
ABprpppa
DB4
ABplppaaaap
ABplap
pm7VL
pm4DL
Dppap
URAVR
ABplapaaaap
ABplapapap
ABalppapppap
P9
ABplpppapap
hyp11
vpi2DL
Cappppv
ABalapappaa
MSpaa
pm2L
RIVR
MSaapaaa
ABarapapaap
ABprpaapapp
DB1
MSpapppap
ABalapaaa
RMDVR
MSaapppp
Eprpp
ABplppppp
MSaappppp
URXL
ABprpap
ABarppaaa
Cappp
ABalpaapap
ABpraapaap
ABaraaapaa
vulB2
CEPshDL
RIML
Cappppd
ABprapapppa
ABalpapppap
ABprapppa
Caapap
Daap
ABalaapp
Dppa
ASHL
RMGR
ABalppppapap
pm3L
ILsoVL
MSpppapa
int3V
LUAR
ABaraapppaad
OLQsoVL
QR.a
AVHR
V4L
ABalappapap
ABarapappap
Cap
Cpapap
OLLshL
virL
arc post DR
mc1DL
ABaraapap
CEPDL
ABalappapp
CEPsoVR
AWAR
GLRVR
ABarpaaaaa
MSappp
ABplaaaaaa
ABalpapapapa
ABalppaapa
ABalapapap
ABprpppapa
MSppap
Eara
ABalaapa
ABaraapapaad
ABprppappp
tail neuron
ABarpappa
ABprpppppp
ABalpapappa
m2L
QL.pp
ABalpappa
ABaraa
MSpappp
OLQDR
Capppap
AVJR
ABalpaaap
MSaapapap
RIH
BDUR
SMDVR
ABarpaap
Cppppp
SMBDL
ABplpaaapp
ABplpppaapa
Dapp
MSapapp
Epr
Capp
ADEshR
PHshR
SIBVL
ABprapaa
ABalaaapar
ABpraappaa
ABarapppap
AIYR
ABprppapa
ABalaaa
ABalpaaaapp
ABalpappaa
ABplapappppa
PVPL
ABplppppppp
ABarapppa
ABprapppp
excretory duct cell
ASIL
ILsoR
ABaraappa
AVBR
PLML
ABaraapaaa
P4
IL2VL
RMEV
int4D
ABaraapppa
M4
MSpapppaa
ABarpppapa
ABplppaaap
AWBL
ABplaaaapp
ABalpppaa
Z2
Capaapa
V2R
ABalaaapal
int8L
SABD
ABplapppapa
ABplappppa
ABalapapapap
pm2DL
ABalapappp
e3D
ABalapppap
MSppppap
LUAL
ABplapaaaaa
Cpaap
QR.pa
pm6VR
vulB1
MSaapaapa
IL1L
ABplppa
ABprpppaaa
pm3DL
AIML
ABplpapaa
ABprpppppa
ABalpaappa
Capaaaa
FLPL
ASER
I1R
pm4L
ABarapppppap
ABalppapppa
MSaapppaa
URYDR
ABarpappp
ABprpppapap
MSaapaa
RMDVL
pm3VL
MCR
ABpraapappp
Caaaaa
ABprppaa
e1VL
anal sphincter muscle
gon_herm_dtc_P
DA4
ABalpapaa
ABplpppap
ABalaapappa
BAGR
ABalaaaarl
DA3
V3R
RMDDR
ABalaaaalp
Cppppap
ABplppaaa
Caaaap
ABplpppp
ABprpapaap
ABpraaapaa
pm6D
ABalpppppa
ABarpppap
ABalpapaap
M
ABplpaapaa
Cppaaa
MSaaaaap
ABarpa
ABpraaaap
Dapap
ILshR
Daapa
hyp2
URADL
ABalaaapp
AVEL
ABarapappp
CEPsoDR
RIVL
MSapaaaa
Eala
MSaaaappa
HSNL
ABarpp
MSapapa
PVQR
ABarappaaap
ABalppppa
AMsoL
ABprapa
ABprpapaaa
Eplp
ABarapaa
MSaaapaa
gon_herm_dtc_A
ABalppaaap
ABplapapa
MSapp
ABpraapapp
ABarpaaapa
ABprppaaaap
ABalpap
ABaraaaa
spike
Capapa
ABplapa
NSML
ABalappaaa
OLQshDR
ABalppapp
int2V
ABalappapa
AVKR
ABpraappap
arc post VL
MSappaa
ABplappaa
Dpppap
ABalppapa
ABalpapppa
Caaaa
ABalappppaa
Cpppapa
pm5DL
G1
ABprappap
ABplaappap
ABplpaappa
ABplpapapp
L1 larva
adult
L2 larva
L3 larva
L4 larva
fully-elongated embryo
elongating embryo
gastrulating embryo
enclosing embryo
WBPaper00002850
gqIs35 [rab-3::ppk-1-GFP, lin-15(+)] GFP IV Expr7821 ppk-1 WBPaper00031242
gqIs37 [unc-47::ppk-1; myo-2:GFP] GFP II
hdIs10 [unc-129::CFP, glr-1::YFP, unc-47::DsRed, hsp-16::rol-6] CFP, YFP, DsRed VH715
VH318
V
hdIs14 [odr-2::CFP, unc-129::YFP, glr-1::DsRed, hsp-16::rol-6] CFP, YFP, DsRed VH431
VH414
IV
hdIs17 [glr-1::YFP, unc-47::YFP, unc-129::YFP, rol-6(su1006)] YFP VH715 I
hdIs26 [odr-2::CFP, sra-6::DsRed2] CFP, DsRed2 VH648 III
hdIs32 [glr-1:DsRed2] DsRed2 VH804 III
icIs103 [hlh-3::gfp] GFP V
idIs5 [fem-1::lacz] LacZ V Expr674 fem-1 Cell embryo
L1 larva
adult
L2 larva
L3 larva
L4 larva
adult male
WBPaper00002504
idIs6 [fem-1::lacz] LacZ II Expr674 fem-1 Cell embryo
L1 larva
adult
L2 larva
L3 larva
L4 larva
adult male
WBPaper00002504
inIs181 [ida-1::gfp] translational fusion, which contains a 2443 bp ida-1 promoter upstream of an ida-1 coding region that incorporates introns 3-9 followed at the 3'-end with in-frame GFP coding sequence and terminating with the unc-54 3'-untranslated region. GFP BL5752
BL5750
IV Expr2970 ida-1 HSNR
amphid neuron
ALA
VC2
VC1
PHCL
VC4
PHCR
VC3
VC6
VC5
HSNL
WBPaper00013484
inIs182 [ida-1::gfp] translational fusion, which contains a 2443 bp ida-1 promoter upstream of an ida-1 coding region that incorporates introns 3-9 followed at the 3'-end with in-frame GFP coding sequence and terminating with the unc-54 3'-untranslated region. GFP BL5752
BL5751
I Expr2970 ida-1 HSNR
amphid neuron
ALA
VC2
VC1
PHCL
VC4
PHCR
VC3
VC6
VC5
HSNL
WBPaper00013484
irIs21 [elt-2::YFP] YFP V
irIs25 [elt-2::GFP] GFP V
irIs42 [hsp-16.1::tbx-35]. A hs-tbx-35 construct (pGB223) was built by cloning a PCR-amplified genomic fragment containing the coding region and introns into plasmid pPD49.83. X
jcIs1 [ajm-1::gfp; unc-29(+); rol-6(su1006)] GFP BP76
BR2958
NW1615
NW1702
NW1704
OH4129
SU93
SU180
WH171
DF67
IV Expr1682 ajm-1 epithelial cell all stages WBPaper00004961
jeIs1 [mec-7::lacZ] translational fusion, with 850bp 5'UTR, 792 bp mec-7 coding region, for the N-term 206 amino acids, lacZ coding region, and 1.3 kb of unc-54 3' UTR. LacZ JW29 I Expr1504 mec-7 FLPR
PVM
PLMR
ALMR
ALNL
ALNR
ALML
AVM
PLML
FLPL
WBPaper00001570
jjIs0709 [lmn-1p::gfp-lmn-1-unc-54 3UTR); pMH86(dpy-20(+)] GFP LW0709 I
jjIs64 [arg-1::gfp] GFP V
jsIs37 [mec-7::snb-1-gfp] GFP NM664
NM1448
NM1455
NM1489
NM2040
V
jsIs40 [mec-7::snb-1-gfp] GFP I
jsIs682 [rab-3::GFP-RAB-3] GFP NM2415 III
juIs73 [unc-25::gfp] GFP IC700
CZ1197
III Marker81 unc-25 WBPaper00032090
juIs76 [unc-25::gfp] GFP CZ1200
CZ1632
CZ1758
CZ1931
CZ1935
OH4121
OH4128
II
kcIs21 [ifb-2::ifb-2-cfp] translational fusion. A plasmid construct encoding IFB-2::CFP was prepared by first amplifying the 1,994 bp ifb-2 promoter fragment from genomic DNA with the help of amplimers 05-143 (5' -CCG CCG AAG CTT CCA TAG GGA AAT CGT GTT ATC-3') and 05-144 (5' -CCG CCG CTG CAG GAT GAA GTC GCT AAA ATT TTG-3'). The HindIII/PstI-cleaved fragment was inserted into the HindIII/PstI sites of the cfp-containing vector pVH10.10, thereby generating plasmid pPifb-2:cfp. For cloning of the 1,646 bp ifb-2 cDNA fragment, ifb-2 cDNA was amplified by PCR using primers 05-145 (5' -CCA CCA CTG CAG ATG TCG GCG GTT AGT TAT TCG-3') and 05-146 (5' -TTA TTA CTG CAG GCA GCG ACC GTC GTC TGG ATG-3'). The PstI-digested product was finally inserted into pPifb-2:cfp to produce pifb-2::cfp. Correct cloning was confirmed by DNA sequencing. CFP BJ52 V Expr8186 ifb-2 intestine WBPaper00031849
kuIs27 [egl-13::gfp] translational fusion. GFP IV
kuIs29 [egl-13::gfp; unc-119(+)] GFP MH1317 V
kuIs34 [sem-4::gfp] translational fusion. A translational fusion containing a SphIPstI genomic fragment, encoding approximately half of SEM-4, fused in frame to GFP. GFP IV Expr949 sem-4 HSNR
P8.p
rect_D
hyp9
DVC
B
P3.p
hyp10
ventral cord neuron
hyp8
P5.p
P6.p
preanal ganglion
P7.p
head
F
P4.p
HSNL
L2 larva WBPaper00004300
kuIs34 [sem-4::gfp] translational fusion. A translational fusion containing a SphIPstI genomic fragment, encoding approximately half of SEM-4, fused in frame to GFP. GFP IV Expr8184 sem-4 Y
B
U
K
F
K'
WBPaper00031556
kuIs46 [ajm-1::gfp; unc-119(+)] GFP MH1384 X
kyIs104 [str-1::gfp] GFP CX3553
PY2223
PY2285
PY2289
X Marker85 str-1 AWBR
AWBL
WBPaper00029131
kyIs105 [str-3::SNB-1::GFP] GFP CX3572 V
kyIs128 [str-3::gfp] GFP CX3596 X
kyIs130 [str-2::snb-1::GFP, lin-15(+)] GFP X
kyIs131 [str-2::gfp] GFP IV Expr1165 str-2 ASIR
AWCR
AWCL
ASIL
L1 larva
fully-elongated embryo
WBPaper00003760
kyIs136 [str-2::GFP, lin-15(+)] GFP X Expr1165 str-2 ASIR
AWCR
AWCL
ASIL
L1 larva
fully-elongated embryo
WBPaper00003760
kyIs137 [str-2::gfp] GFP V Expr1165 str-2 ASIR
AWCR
AWCL
ASIL
L1 larva
fully-elongated embryo
WBPaper00003760
kyIs140 [str-2::gfp] GFP CX3695
CX3933
CX3940
CX4828
CX4998
CX5757
CX5893
CX5922
OH4768
LG313
PY1133
I Expr1165 str-2 ASIR
AWCR
AWCL
ASIL
L1 larva
fully-elongated embryo
WBPaper00003760
kyIs150 [tax-2(deletion)::gfp] GFP CX4103 IV
kyIs156 [str-1::odr-10-gfp]. GFP CX3877 X
kyIs164 [gcy-5::gfp] GFP II
kyIs170 [srh-220::gfp, lin-15(+)] GFP I
kyIs174 [slt-1::gfp] transcriptional fusion, with 4 kb of potential regulatory sequence upstream of the slt-1 initiator methionine, with the first two codons of slt-1. GFP V Expr1639 slt-1 hyp1
hyp3
hyp6
RMED
BDUL
hyp5
body wall musculature
socket cell
RIH
BDUR
anal sphincter muscle
hyp2
hyp4
adult
larva
2-fold embryo
3-fold embryo
fully-elongated embryo
comma embryo
1.5-fold embryo
WBPaper00004900
kyIs179 [unc-86::gfp, lin-15(+)] GFP IV Marker79 unc-86 HSNR
HSNL
WBPaper00031910
kyIs187 [str-2::odr-10] CX4915 X
kyIs192 [mec-7::myr::unc-40, str-1::gfp] GFP II
kyIs200 [sra-6::VR1(cDNA)(100ng); elt-2::gfp(10ng)] VR1. VR1 is the mammalian TRPV1 channel that share similarity to OSM-9 in C. elegans. --wjc. X
kyIs209 [myo-3::slt-1]. Integrant of myo-3::slt-1 misexpressing slt-1 in all body wall muscles X
kyIs218 [myo-3::slt-1]. The full-length slt-1 cDNA was cloned into the KpnI/SacI sites of pPD96.52, directly downstream of the myo-3 promoter. X
kyIs235 [unc-86::snb-1::yfp, unc-4::lin-10::dsRED, odr-1::dsRED] YFP CX652 V
kyIs258 [odr-1::DsRed, unc-122::GFP] GFP X
kyIs262 [unc-86::myr-GFP, odr-1::dsred] GFP IV
kyIs29 [glr-1::gfp] GFP CX2835 X Expr247 glr-1 AVAL
AIBL
PVCL
AVDL
AVAR
AVBL
SMD
URY
AIBR
PVCR
AVER
PVQL
AVDR
AVG
RIMR
RIML
AVBR
RMD
AVEL
PVQR
WBPaper00002308
kyIs299 [hsp16-2::unc-6::HA; unc-86::myr-GFP; odr-1::DsRed] GFP X
kyIs323 [str-2::GFP, unc-122::GFP] GFP II
kyIs37 [odr-10::gfp]. With the odr-10 promoter and the first 6 amino acids of ODR-10 fused to GFP. GFP CX3260 II Expr280 odr-10 AWAL
AWAR
WBPaper00002421
kyIs38 [odr-7p::gfp] GFP PY1060 X
kyIs39 [sra-6::gfp] GFP CX3465
CX3350
I Expr296 sra-6 SPVL
ASIR
SPVR
SPDL
ASHR
SPDR
PVQL
ASHL
ASIL
PVQR
adult male WBPaper00002314
kyIs4 [ceh-23-unc-76-gfp::lin-15] CX188
CX2565
CX2993
CX3125
CX3137
CX2627
X
kyIs5 [ceh-23-unc-76-gfp::lin-15] NG2501
CX2644
IV
kyIs53 [odr-10::gfp]. GFP tagged full length ODR-10. GFP CX3344 X Marker84 odr-10 AWAL
AWAR
WBPaper00029131
kyIs8 [ceh-23::gfp, lin-15(+)] GFP I
kyIs90 [odr-3 pro::odr-3(1st 35 aa's)::GFP lin-15(+)] GFP III
lqIs10 [ceh-10::gfp, lin-15(+)] GFP LE332 X
lqIs2 [osm-6::gfp, lin-15(+)] GFP LE309 X
lqIs3 [osm-6::gfp] GFP LE310
LE1212
LE1213
IV
lqIs40 [gcy-32::gfp] GFP I
ltIs37 [pie-1::mCHERRY-HIS-58; unc-119 (+)] mCHERRY OD83
OD139
OD141
IV
ltIs44 [pie-1::PHdomain-mCherry] mCherry DG2160
DG2189
OD70
V
lwIs16 [act-4::LacZ] LacZ PJ1077
EH16
X
mIs10 [myo-2::GFP, pes-10::gfp, F22B7.9::gfp] GFP PD4793
VC148
V
mIs11 [myo-2::gfp] GFP CA538
HC114
HC271
PD4792
VC49
VC177
VC485
IV
mIs12 [myo-2::GFP, pes-10::GFP, F22B7.9::GFP] GFP CB5584
PD4790
II
mIs13 [myo-2::GFP, pes-10::GFP, gut::GFP] expresses GFP under the control of the pharynx-specific myosin-2 (myo-2) promoter, the germline-specific pes-10 promoter as well as a gut specific enhancer. GFP PD4788
VC129
VC307
VC404
I
mIs14 [myo-2::gfp; pes-10::gfp] containing the myo-2 and pes-10 promoters and a gut enhancer fused individually to the GFP. GFP AD226
BP601
BP610
BS3493
DG1612
DG1650
DR2078
DZ205
DZ240
GC565
HS458
IC361
JK3107
JK3172
JK3182
JK3345
JK3375
JN214
LB21
ML1213
MT12352
NG3124
NG3190
PS4886
PS5131
SA25
SL740
SL940
SL978
SU351
SU352
VC28
VC42
VC114
VC170
VC185
VC206
VC277
VC294
VC308
VC337
VC354
VC363
VC368
VC384
VC389
VC407
VC455
VC465
VC515
VC516
VC536
VC559
VC570
VC572
VC598
VC611
VC663
VC682
VC695
VC703
VC704
VC715
VC724
VC735
VC774
VC777
VC778
VC789
VC842
VC895
VC898
VC902
VC926
VC946
VC965
VC984
VC1016
VC1033
VC1049
VC1082
VC1112
VC1123
VC1135
VC1158
VC1165
VC1274
VC1275
VC1300
VC1330
VC1333
VC1336
VC1345
VC1368
VC1401
VC1424
VC1426
VC1438
VC1458
VC1474
VC1498
VC1505
VC1506
VC1636
VC1710
VC1781
VC1783
VC1790
VC1794
VC1832
VC1834
VC1887
VC1888
VC1914
VC1998
VC2013
VC2033
VC2091
VC2151
VC2165
VC2186
VC2226
VC2308
VC2383
VC10002
VC10005
VC10007
II
mIs6 [daf-7::gfp, rol-6(su1006)] GFP DR1808 X
maIs103 [rnr::gfp] GFP SV273
SV275
SV411
VT765
VT774
X
mcIs11 [lin-26(+)]. Integrated expression line for lin-26 promoter deletion construct III
mcIs14 [lin-26(+)]. Integrated expression line for lin-26 promoter deletion construct. IV
mfIs41 [lip-1::NLS-YFP, myo-2::DsRED, unc-119(+)] YFP, DsRED II
mgIs18 [ttx-3::gfp] GFP OH99
OH160
OH912
OH2018
OH7566
IV Expr1352 ttx-3 ADLR
ASIR
ADLL
pharyngeal neuron
AIYL
AIAR
AIAL
AIYR
ASIL
postembryonic WBPaper00004727
mgIs32 [ttx-3::gfp; lin-15(+)] GFP III Expr1352 ttx-3 ADLR
ASIR
ADLL
pharyngeal neuron
AIYL
AIAR
AIAL
AIYR
ASIL
postembryonic WBPaper00004727
mgIs45 [mir-84(+); tub-1::gfp] GFP GR1446
GR1426
GR1428
GR1447
I
mgIs49 [mlt-10::gfp-pest; ttx-3::gfp] GFP GR1438
GR1395
GR1437
GR1436
IV
mnIs17 [osm-6::gfp; unc-36(+)] GFP SP2101 V Expr507 osm-6 ADER
ADLR
IL1DR
OLLL
IL2L
ASIR
PQR
IL1VR
PHAR
AWBR
CEPVR
ADLL
OLQVR
ASGL
AWAL
ADEL
IL2DR
ASKL
AWCR
OLQDL
ASJL
CEMVR
AQR
IL1DL
ADFL
OLQVL
CEMVL
IL1VL
IL2VR
ASHR
ASEL
AWCL
CEMDL
IL1R
PHAL
AFDL
CEPDR
IL2R
PHBR
OLLR
AFDR
ASGR
ASKR
PHBL
CEPVL
ASJR
IL2DL
ADFR
CEMDR
ASHL
PDEL
CEPDL
AWAR
OLQDR
ASIL
IL2VL
AWBL
IL1L
ASER
CEM
PDER
L1 larva
adult
L2 larva
L3 larva
L4 larva
fully-elongated embryo
WBPaper00002980
mnIs17 [osm-6::gfp; unc-36(+)] GFP SP2101 V Marker73 osm-6 amphid neuron
phasmid neuron
WBPaper00031375
mnIs7 [lin-44::gfp; unc-29(+)] GFP SP1914 X
muIs10 [hsp-16.1::mab-5; C14G10(unc-31+)] X
muIs102 [gcy-32::gfp] GFP V
muIs109 [daf-16::gfp::daf-16; odr-1::rfp] GFP CF1935
CF2135
X
muIs13 [egl-5::lacZ] LacZ CF391 V Expr8261 egl-5 HSNR
HSNL
WBPaper00031910
muIs16 [mab-5::gfp] GFP CF453
HZ111
HZ112
II
muIs2 [mab-5::lacZ; unc-31(+)], contained 7 kb upstream of mab-5 and the first 17 amino acids of coding sequence. Transgenic markers: Unc-31 LacZ CF237
CF182
CF190
CF180
CF186
IV Expr585 mab-5 ABplppppap
V3L
P6
ABplppppa
H1R
V5R
P8
hypodermis
V6R
ABplppppaa
ABprppppa
V1L
P11
P1
ABplpppppp
P10
ABprppppaa
P3
H1L
ABprppppp
TR
V6L
TL
V5L
P5
ABplpppppa
H2L
H2R
V1R
P7
P2
ABprppppap
V4R
V2L
P12
P9
ABplppppp
V4L
ABprpppppp
P4
V2R
ABprpppppa
V3R
L1 larva
gastrulating embryo
enclosing embryo
1.5-fold embryo
WBPaper00001639
muIs3 [mab-5::lacZ; unc-31(+)], contained 7 kb upstream of mab-5 and the first 17 amino acids of coding sequence. Transgenic markers: rol-6(su1006). LacZ CF196
CF236
V Expr585 mab-5 ABplppppap
V3L
P6
ABplppppa
H1R
V5R
P8
hypodermis
V6R
ABplppppaa
ABprppppa
V1L
P11
P1
ABplpppppp
P10
ABprppppaa
P3
H1L
ABprppppp
TR
V6L
TL
V5L
P5
ABplpppppa
H2L
H2R
V1R
P7
P2
ABprppppap
V4R
V2L
P12
P9
ABplppppp
V4L
ABprpppppp
P4
V2R
ABprpppppa
V3R
L1 larva
gastrulating embryo
enclosing embryo
1.5-fold embryo
WBPaper00001639
muIs32 [mec-7::GFP] GFP CF1665
CF1756
KN369
KN387
KN562
NW1701
II
muIs35 [mec-7::gfp; lin-15(+)] GFP CF1192
CF1632
CF703
V
muIs4 [mab-5::lacZ, rol-6(d)] LacZ I
muIs49 [egl-20::gfp; unc-22 antisense]. Rescuing egl-20::gfp translational fusion GFP CF1045 V Expr989 egl-20 muscle cell embryo
L1 larva
WBPaper00003818
muIs49 [egl-20::gfp; unc-22 antisense]. Rescuing egl-20::gfp translational fusion GFP CF1045 V Expr3846 egl-20 hypodermis
muscle cell
L1 larva
L2 larva
L3 larva
L4 larva
fully-elongated embryo
elongating embryo
WBPaper00027140
muIs49 [egl-20::gfp; unc-22 antisense]. Rescuing egl-20::gfp translational fusion GFP CF1045 V Expr3848 egl-20 hypodermis
muscle cell
L1 larva
L2 larva
L3 larva
L4 larva
2-fold embryo
3-fold embryo
comma embryo
1.5-fold embryo
WBPaper00027140
muIs5 [lin-39::lacZ] LacZ X
muIs6 [lin-39::lacZ] LacZ CF267 IV
muIs71 [daf-16a::gfp/bKO]. A frameshift mutation was introduced into the DAF-16b-specific exon upstream of the winged-helix domain by digestion with NgoMIV followed by `fill-in' and re-ligation of DAF-16a::GFP to generate DAF-16a::GFP/bKO. GFP CF1407 X Expr3117 daf-16 WBPaper00024399
muIs71 [daf-16a::gfp/bKO]. A frameshift mutation was introduced into the DAF-16b-specific exon upstream of the winged-helix domain by digestion with NgoMIV followed by `fill-in' and re-ligation of DAF-16a::GFP to generate DAF-16a::GFP/bKO. GFP CF1407 X Expr3860 daf-16 WBPaper00027074
muIs9 [hs::mab-5; C14G10(unc-31+)] CF301
CF303
X
mxIs14 [egl-1::histone-gfp] transcariptional fusion. GFP X Expr3857 egl-1 WBPaper00027049
myIs1 [pkd-2::gfp] GFP IV Expr7822 pkd-2 WBPaper00031243
myIs4 [pkd-2::gfp; cc::gfp] GFP V Expr4254 pkd-2 R3BR
R7BR
R4BR
R2BL
R8BR
CEMVR
HOB
CEMVL
R5BR
R2BR
R4BL
R3BL
CEMDL
R1BR
R9BL
R9BR
CEMDR
R8BL
R7BL
R5BL
R1BL
WBPaper00028448
nIs106 [lin-11::gfp]. containing 5.2 kb of 5'UTR and ATG codon of lin-11. GFP X Marker17 lin-11 P5.p
P7.p
WBPaper00026909
nIs118 [cat-2::gfp, lin-15] GFP X
nIs128 [pkd-2::gfp] GFP II
nIs133 [pkd-2::gfp] GFP I
nIs181 [egl-6(+) lin-15AB(+)] X
nIs2 [lin-11::lacZ; lin-11(+)] LacZ MT5788
MT5790
MT5797
MT5798
VT664
IV Expr1033 lin-11 uv1
uterine seam cell
WBPaper00003850
nIs209 [flp-10(+) lin-15AB(+)] II
nIs211 [flp-17(+) lin-15AB(+)] IV
nIs213 [egl-6::gfp lin-15AB(+)] GFP II
nIs242 [gcy-33::gfp(+) lin-15AB(+)] GFP III
nIs253 [flp-10::gfp(+) lin-15AB(+)] GFP X
nIs257 [flp-17::gfp lin-15AB(+)] GFP I
nIs51 [egl-10(+)]. Integrated line overexpressing egl-10 genomic fragment MT8190 X
nIs54 [egl-10(+); lin-15(+)] X
nIs83 [mec-4::gfp] GFP V
nIs96 [lin-11::gfp]. containing 5.2 kb of 5'UTR and ATG codon of lin-11. GFP PS3493
PS3494
V Expr2574 lin-11 vulC
head neuron
proct
ventral cord neuron
vulA
uterine toroidal epithelial cell
vulF
vulE
vulD
vulB2
tail neuron
vulB1
adult
L4 larva
WBPaper00005954
ncIs2 A promoter trap construct in which a genomic fragment drives the expression of GFP in all neurons. GFP ST2
ST15
ST16
ST20
ST21
ST22
ST30
ST35
II
ncIs3 A promoter trap construct in which a genomic fragment drives the expression of GFP in all neurons. GFP ST29
ST53
III
nrIs20 [sur-5::nls-gfp] GFP IV
nsIs105 [hlh-17::GFP] GFP I Marker29 hlh-17 CEPshVL
ventral cord neuron
CEPshDR
CEPshVR
CEPshDL
embryo
L1 larva
adult
L2 larva
L3 larva
L4 larva
WBPaper00031917
nsIs113 [F16F9.3 pro::DT-A(G53E) unc-122 pro::GFP] DT-A(G53E) X
nsIs136 [ptr-10::myrRFP] myrRFP IV Marker30 ptr-10 ILsoDR
ILsoDL
ILshDL
PDEshR
CEPshVL
OLQshVR
ILshDR
OLLsoR
OLQsoDR
ILshVR
OLLshR
PDEsoR
CEPshDR
OLLsoL
ILsoL
OLQshVL
ILshVL
OLQsoVR
OLQshDL
ILsoVR
OLQsoDL
CEPshVR
ADEshL
ILshL
ADEsoR
ADEsoL
CEPshDL
ILsoVL
OLQsoVL
OLLshL
ADEshR
ILsoR
PDEsoL
PDEshL
ILshR
OLQshDR
WBPaper00031917
nsIs145 [ttx-1::RFP] RFP V
nsIs25 [(cb)ced-3::gfp] GFP X
ntIs1 [gcy-5::gfp] GFP OH2871
OH3192
OH7566
V Marker14 gcy-5 ASER WBPaper00028862
nuIs1 [glr-1::gfp] GFP KP987 X Marker60 glr-1 RIS WBPaper00006180
nuIs11 [osm-10::gfp] translated fusion GFP HA3
OH4769
I Expr1266 osm-10 ASIR
PHAR
ASHR
PHAL
PHBR
PHBL
ASHL
ASIL
postembryonic WBPaper00003408
nuIs9 [unc-5B::gfp; myo-3::lacZ; dpy-20(+)] LacZ I
opIs110 [lim-7::yfp-act-5] YFP IV Expr3724 act-5 WBPaper00025002
opIs160 [yfp::ced-6; unc-119(+)] YFP X
opIs64 [gla-3a::2xNLS-gfp unc-119(+)] GFP III Expr7991 gla-3 muscle cell
germ line
embryo
adult
L4 larva
WBPaper00028398
otIs114 [lim-6::gfp, rol-6(d)] GFP OH707
OH812
OH1571
OH3487
OH3491
OH3556
OH3568
OH3645
OH3646
OH3679
OH3681
OH3684
OH3754
OH3895
OH3900
OH3902
OH3903
OH3926
OH3928
OH3959
OH3962
OH4013
OH4025
OH4027
OH4176
OH4830
OH4974
OH7115
OH8001
I Marker41 lim-6 excretory gland cell
ASEL
WBPaper00006052
otIs125 [flp-6::gfp] GFP X Marker42 flp-6 ADFL
ASEL
AFDL
AFDR
ADFR
ASER
WBPaper00006052
otIs13 [zig-3::gfp] promoter fusion. PCR product of the promoter region -4449 to -1 relative to ATG were fused to the polylinker of the gfp vector pPD95.75. GFP I Expr1749 zig-3 ASIR
PVT
AIMR
vulva
body wall musculature
ASIL
AIML
postembryonic WBPaper00005064
otIs3 [gcy-7::gfp] GFP OH3191
OH4605
OH7116
OH811
V Marker13 gcy-7 ASEL WBPaper00028862
otIs33 [kal-1::gfp] GFP OH904 IV Marker49 kal-1 HSNR
ASIR
excretory cell
CANR
CANL
DVC
AIYL
PVM
ventral cord neuron
M5
inner labial neuron
AIZR
outer labial neuron
PDB
DVB
AIZL
RID
uterine muscle
AIYR
ASIL
HSNL
WBPaper00004727
otIs33 [kal-1::gfp] GFP OH904 IV Marker64 kal-1 RID WBPaper00006180
otIs35 [ttx-3::kal-1] OH911
OH2018
X
otIs45 [unc-119::gfp] GFP OH441 V Marker50 unc-119 neuron WBPaper00004727
otIs76 [ttx-3::kal-1] OH160
OH912
IV
otIs77 [ttx-3::kal-1] OH910
NP97
II
otIs80 [unc-119::kal-1] IV
otIs81 [unc-119::kal-1] II
otIs83 [gcy-8::kal-1] V
otIs92 [flp-10::gfp]. Derived from an extrachromosomal array provided by C. Li GFP OH4841 V Expr3011 flp-10 AUAR
ASIR
PQR
PVR
AIMR
BDUL
BAGL
AUAL
DVB
URXR
vulD
URXL
BDUR
ASIL
AIML
BAGR
WBPaper00024197
otIs93 [flp-10::gfp] GFP II Expr3011 flp-10 AUAR
ASIR
PQR
PVR
AIMR
BDUL
BAGL
AUAL
DVB
URXR
vulD
URXL
BDUR
ASIL
AIML
BAGR
WBPaper00024197
otIs97 [unc-119::ttx-3; pRF4] IV
oxIs107 [rab-3::UNC-70(5ng/uL); myo-2::GFP(2ng/uL); lin-15(+)]. For oxIs107, the extrachromosomal array oxEx506, containing rab-3::UNC-70(5ng/uL), myo-2::GFP(2ng/uL), and lin-15(+) 80ng/uL, was generated by standard microinjection techniques. This array was then integrated by X-ray irradiation to generate oxIs107, mapped 8/38 to dpy-11. GFP V
oxIs12 [unc-47::gfp] GFP EG1285
HJ1
HJ154
OH775
OH1003
OH1476
OH1589
OH2000
OH2096
OH2344
OH2345
OH2346
OH2347
OH2382
OH2383
EG1524
VH431
EG1306
VH984
X Marker21 unc-47 GABAergic neuron WBPaper00031112
oxIs131 [rab-3::UNC-70 (5ng/uL); unc-129::GFP(20ng/uL); and lin-15(+)(80ng/uL)]. The starting array was oxEx508, containing rab-3::UNC-70 (5ng/uL), unc-129::GFP(20ng/uL), and lin-15(+)(80ng/uL). The integrant mapped 0/12 to dpy-11. GFP V
oxIs25 [Mos1; rol-6(sd)] The Mos1-containing array oxEx164[Mos1; rol-6(sd)] was built by injecting a fragment containing the 1.3-kb Mos1 element flanked by Drosophila simulans sequences18 (10 ng/ml) and a fragment of pRF4(rol-6(sd) (10 ng/ml). The integrated array oxIs25[Mos1; rol-6(sd)] contained 1520 Mos1 elements as determined by Southern blot analysis. V
oxIs250 [unc-122::GFP Cbr-unc-119(+)] GFP EG4369 II
oxIs251 [unc-122::GFP Cbr-unc-119(+)] GFP EG4441 II
oxIs252 [unc-122::GFP Cbr-unc-119(+)] GFP EG4442 II
oxIs253 [unc-122::GFP Cbr-unc-119(+)] GFP EG4443 II
oxIs254 [unc-122::GFP Cbr-unc-119(+)] GFP EG4444 II
oxIs255 [unc-122::GFP Cbr-unc-119(+)] GFP EG4445 II
oxIs256 [unc-122::GFP Cbr-unc-119(+)] GFP EG4446 II
oxIs257 [unc-122::GFP Cbr-unc-119(+)] GFP EG4447 II
oxIs258 [unc-122::GFP Cbr-unc-119(+)] GFP EG4448 II
oxIs259 [unc-122::GFP Cbr-unc-119(+)] GFP EG4449 II
oxIs260 [unc-122::GFP Cbr-unc-119(+)] GFP EG4450 II
oxIs269 [unc-122::GFP Cbr-unc-119(+)] GFP EG4584 IV
oxIs270 [unc-122::GFP Cbr-unc-119(+)] GFP EG4585 IV
oxIs271 [unc-122::GFP Cbr-unc-119(+)] GFP EG4586 IV
oxIs272 [unc-122::GFP Cbr-unc-119(+)] GFP EG4587 IV
oxIs273 [unc-122::GFP Cbr-unc-119(+)] GFP EG4588 IV
oxIs274 [unc-122::GFP Cbr-unc-119(+)] GFP EG4589 IV
oxIs279 [pie-1::GFP::histone br-unc-119(+)] GFP EG4601 II
oxIs30 [Mos1 Transposase] X
oxIs300 [unc-18::mCherry Cbr-unc-119(+)] mCherry EG4851 II
oxIs301 [unc-18::mCherry Cbr-unc-119(+)] mCherry EG4852 II
oxIs303 [pie-1::GFP::histone br-unc-119(+)] GFP EG4858 II
oxIs304 [unc-47::mCherry::unc-54utr CB-unc-119(+)] mCherry EG4863 II
oxIs305 [dpy-30::mCherry::histone Cbr-unc-119(+)] mCherry, histone EG4864 II
oxIs314 [unc-122::GFP Cbr-unc-119(+)] GFP EG4879 II
oxIs315 [unc-122::GFP Cbr-unc-119(+)] GFP EG4880 II
oxIs318 [spe-11::mCherry::histone Cbr-unc-119(+)] mCherry, histone EG4883 II
oxIs324 [unc-122::GFP Cbr-unc-119(+)] GFP EG4890 II
oxIs325 [unc-122::GFP Cbr-unc-119(+)] GFP EG4891 II
oxIs326 [unc-122::GFP Cbr-unc-119(+)] GFP EG4892 II
oxIs327 [unc-122::GFP Cbr-unc-119(+)] GFP EG4893 II
oxIs328 [unc-122::GFP Cbr-unc-119(+)] GFP EG4894 II
oxIs329 [unc-122::GFP Cbr-unc-119(+)] GFP EG4895 II
oxIs33 [unc-64(+); unc-122::gfp] GFP I
oxIs34 [unc-64(L166A/E167A); myo-2::gfp] GFP III
oxIs359 [spe-11::GFP::HIS CB-unc-119(+)] GFP EG5061 II
oxIs360 [spe-11::GFP::HIS CB-unc-119(+)] GFP EG5062 II
oxIs361 [spe-11::GFP::HIS CB-unc-119(+)] GFP EG5063 II
oxIs95 [pdi-2::unc-70] IV
oyIs14 [sra-6::gfp] GFP OH2638
OH2639
OH3313
OH3314
OH3455
OH3467
OH3478
OH4124
OH4127
OH4139
OH4140
PY1058
CX5334
V Marker47 sra-6 PVQL
PVQR
WBPaper00005633
oyIs17 [gcy-8::gfp; lin-15(+)] GFP PY1260
PY1283
V Marker58 gcy-8 AFDL
AFDR
WBPaper00004727
oyIs45 [odr-1 pro::RFP] RFP V
pkIs1600 [dpy-30::gfp{Delta}::unc-54; pRF4(rol-6(su1006))] GFP NL3847 I
pkIs296 [hsp::gsa-1(Q208L); dpy-20(+)] NL545
NL585
NL587
NL597
NL1236
NL1908
NL1909
NL1921
NL1925
NL1947
NL3231
NL520
X
pkIs41 [kin-29::gfp] GFP PY3018 IV
pmid16204351Is1 [aex-3::{alpha}-synuclein(A53T); Pdat-1::gfp] GFP WG8 IV
qIs19 An integration of [lag-2::gfp] on Chromosome V. GFP JK2049
YG1011
JK2822
V Expr3843 lag-2 gon_male_dtc
gon_male_dtc
gon_herm_dtc_P
gon_herm_dtc_A
linker cell
WBPaper00005116
qIs23 An integration of [lag-2::gfp] on Chromosome I. GFP I
qIs42 [pha-4::gfp; pRF4] GFP IV
qIs54 [myo-2::GFP, pes-10::GFP, gut promoter::GFP] GFP JK2735 X
qIs56 [lag-2::gfp; unc-119(+)] GFP JK2868 V Expr3843 lag-2 gon_male_dtc
gon_male_dtc
gon_herm_dtc_P
gon_herm_dtc_A
linker cell
WBPaper00005116
qIs56 [lag-2::gfp; unc-119(+)] GFP JK2868 V Expr8182 lag-2 dauer larva WBPaper00031997
qIs57 [lag-2::gfp] GFP II
qIs95 [sys-1::VENUS::SYS-1] VENUS JK3791 III Expr4710 sys-1 Z1.aa
gon_herm_dtc_P
WBPaper00029120
qaIs2241 [gcy-36::egl-1, gcy-35::gfp, lin-15(+)] GFP CX7102 X
quIs5 [mec-4::myr-vab-1] IC400 II
rhIs13 [unc-119::gfp] GFP VH624
VH41
V
rhIs16 [glr-1::CFP; dpy-20(+)] GFP VH94 X
rhIs23 [him-4::gfp] translational fusion. Using overlapping PCR primers, a unique SacII restriction site was insertedinto the hemicentin coding region, changing nucleotides F15G9:13,573-13,578 to ATC.TGG.CCC.GCG.GTC.TTC. The coding sequence for GFP from plasmid pPD113.54 was inserted in-frame into this restriction site. GFP III
rhIs4 [glr-1::gfp] GFP OH4120
OH4132
OH4136
VH4
VH17
VH1160
IM486
IM549
IM206
IM516
IM525
IM175
IM500
IM526
IM536
IM485
IM488
IM509
VH15
VH616
IM534
IM203
IM546
IM507
IM204
IM535
IM336
IM487
IM518
IM499
IM508
IM202
IM543
IM205
IM527
IM498
IM517
IM484
III
rrIs1 [elt-2::GFP, unc-119(+)] GFP MR142
MR164
X Marker26 elt-2 intestine WBPaper00031534
rtIs11 [osm-10::gfp; osm-10::Htn-Q150]. An integration into chromosome V of the extrachromosomal array rtEx1, which contains pHA#16(osm-10::Htn_Q150), pDPY20, and pKP#58(osm-10::gfp). Htn-Q150 is huntingtin (Genbank no. L13292) with polyQ tracts of150 residues. GFP HA659
HA759
V
rtIs18 [elt-2::gfp; osm-10::Htn-Q150]. rtIs18 is an integration into chromosome I of the extrachromosomal array rtEx362, which contains pHA#16 and elt-2::GFP. GFP HA661 I
rtIs25 [sra-6::YC2.12] YC2.12 HA1203 X
ruIs1 [unc-119::unc-119+sup-7 suppressor tRNA gene] AZ60 IV
ruIs10 [unc-119::unc-119+sup-7 suppressor tRNA gene] AZ69 III
ruIs25 [unc-119::unc-119(+)] AZ199 V
ruIs26 [unc-119::unc-119(+)] AZ200 III
ruIs27 [unc-119::unc-119(+)] AZ205 I
ruIs3 [unc-119::unc-119+sup-7 suppressor tRNA gene] AZ62 IV
ruIs32 [pie-1::GFP-his-11, unc-119(+)] GFP AZ212
NL3847
OC95
RW10006
TH32
TY3558
XA3501
TH33
NL3630
III Marker76 his-11 WBPaper00031431
ruIs33 [pie-1::GFP:H2B:pie-1]. Both unc-119::unc-119(+) injextion marker and pri-1::GFP are in the same plasmid pAZ132. GFP AZ213 V
ruIs34 [pie-1::GFP:H2B:pie-1]. Both unc-119::unc-119(+) injextion marker and pie-1::GFP are in the same plasmid pAZ132. GFP AZ214 I
ruIs37 [myo-2::GFP]. Both unc-119::unc-119(+) injextion marker and myo-2::GFP are in the same plasmid pAZ119. GFP AZ217 III
ruIs38 [myo-2::GFP]. Both unc-119::unc-119(+) injextion marker and myo-2::GFP are in the same plasmid pAZ119. GFP AZ218 III
ruIs59 [unc-119::unc-119(+)] AZ173 III
saIs5 [P10G10(+); pRF4] V
smIs1 [mec-3::gfp; mec-7::mec-3]smIs1 was generated by integrating through exposure to gamma-rays an extrachromosomal array containing Pmec-7acCED-3(10mg/ml), Pmec-3GFP (10mg/ml1) and pL15EK (40mg/ml), a plasmid that rescues lin-15 mutant, into lin-15(n765ts) animals. It was then backcrossed six times with N2 animals and mapped to LGV. GFP V
smIs111 [egl-1::acCED-3] X
smIs13 I
smIs23 [pkd-2::gfp] GFP II
smIs26 [pkd-2::gfp] GFP IV
smIs54 [ceh-30::ceh-30-gfp] GFP X Expr7849 ceh-30 CEMVR
CEMVL
CEMDL
CEMDR
embryo
L1 larva
adult
L2 larva
L3 larva
L4 larva
WBPaper00031299
smIs76 [PhspANV::GFP] GFP V
swIs1 [rol-6(su1006); ceh-13::gfp] GFP FR317 II Expr513 ceh-13 ABplppp
intestine
ABprpp
Epl
ABprppp
ABplapp
ABprapp
Da
ABalppa
Ep
ABalapa
ABalpp
ABarppp
ABprap
ABprppa
ABarppa
ABarap
Dp
ABalapp
ABplpp
ABalap
ABarapa
ABalppp
ABarapp
ABplap
Epr
ABplppa
ABarpp
ABprapa
ABplapa
blastula embryo WBPaper00002941
swIs1 [rol-6(su1006); ceh-13::gfp] GFP FR317 II Expr1771 ceh-13 ABprpp
ABara
ABarp
hypodermis
ABpra
ABpla
male-specific
Ep
ABalpp
ABala
ventral cord neuron
ABprp
ABprap
ABarap
ABplpp
ABalap
body wall musculature
ABalp
ABplap
ABplp
ABarpp
adult
larva
fully-elongated embryo
elongating embryo
gastrulating embryo
enclosing embryo
WBPaper00005094
swIs15 [ceh-13(enh740)::gfp rol-6(su1006)] GFP V
swIs79 [ajm-1::gfp, unc-119(+)] GFP IV
syIs1 [lin-3(+)]. lin-3 and an unc-31 subclone with selective marker. PS1123 X
syIs101 [T04B2.6::yfp] YFP PS3722 IV Expr2358 dhs-31 vulD
vulB2
vulB1
adult WBPaper00013312
syIs102 [T04B2.6::cfp] CFP PS3724 X Expr2358 dhs-31 vulD
vulB2
vulB1
adult WBPaper00013312
syIs118 [fos-1a::YFP-TX] YFP PS4441 I
syIs12 [hsLIN-3EGF; dpy-20(+)] PS2037 II
syIs129 [hemicentin-SP::GFP] GFP PS4444 III
syIs137 [fos-1b::CFP-TX] CFP PS4558 III
syIs17 [hsp16-2::goa-1(Q205L); dpy-20(+)]. Integrated transgenic line of activated Goa under the control of hsp16-2 promoter. PS1681
PS3351
IV
syIs20 [gpa-1::lacZ; dpy-20(+)] LacZ PS1702
PS2767
PS2943
PS3170
V Expr522 gpa-1 PHAR
SPDL
PHAL
SPDR
head
PHBR
PHBL
adult WBPaper00003453
syIs25 [gpa-3::gpa-3(QL)]. QL means a constitutive activating mutation. PS2109 X
syIs49 [zmp-1::gfp] GFP PS3239 IV Expr1720 zmp-1 vulval cell
Anchor cell
vulval cell
vulval cell
vulval cell
vulval cell
vulE
vulval cell
vulval cell
vulval cell
adult
L3 larva
L4 larva
WBPaper00004481
syIs49 [zmp-1::gfp] GFP PS3239 IV Expr2357 zmp-1 vulA
vulE
vulD
adult
L4 larva
WBPaper00013312
syIs50 [cdh-3::gfp] GFP PS3352
YG1007
X Expr2355 cdh-3 vulC
vulF
vulE
vulD
adult
L4 larva
WBPaper00013312
syIs51 [cdh-3::cfp] CFP PS3475
PS3528
V Expr2355 cdh-3 vulC
vulF
vulE
vulD
adult
L4 larva
WBPaper00013312
syIs52 [cdh-3::cfp] CFP PS3476 X Expr2355 cdh-3 vulC
vulF
vulE
vulD
adult
L4 larva
WBPaper00013312
syIs54 [ceh-2::gfp] GFP PS3504
PS3634
PS5136
II Expr2356 ceh-2 vulC
vulB2
vulB1
adult
L4 larva
WBPaper00013312
syIs55 [ceh-2::yfp] YFP PS3528
PS5419
PS3505
X Expr2356 ceh-2 vulC
vulB2
vulB1
adult
L4 larva
WBPaper00013312
syIs56 [ceh-2::yfp] YFP PS3506 V Expr2356 ceh-2 vulC
vulB2
vulB1
adult
L4 larva
WBPaper00013312
syIs57 [cdh-3::cfp] CFP PS3517 X Expr2355 cdh-3 vulC
vulF
vulE
vulD
adult
L4 larva
WBPaper00013312
syIs59 [egl-17::cfp] CFP PS3525 X Expr2354 egl-17 vulC
vulF
vulE
vulD
L3 larva
L4 larva
WBPaper00013312
syIs60 [F47B8.6::gfp] GFP PS3526 II Expr2360 F47B8.6 vulC
vulF
vulE
vulD
adult WBPaper00013312
syIs61 [F47B8.6::gfp] GFP PS3527 V Expr2360 F47B8.6 vulC
vulF
vulE
vulD
adult WBPaper00013312
syIs65 [B0034.1::pes-10::gfp] GFP PS3664 IV Expr2359 B0034.1 vulF
vulE
adult
L4 larva
WBPaper00013312
syIs66 [B0034.1::pes-10::gfp] GFP PS3665 II Expr2359 B0034.1 vulF
vulE
adult
L4 larva
WBPaper00013312
syIs67 [zmp-1::pes-10::cfp] CFP PS3666 V Expr2357 zmp-1 vulA
vulE
vulD
adult
L4 larva
WBPaper00013312
syIs68 [zmp-1::pes-10::cfp] CFP PS3667 IV Expr2357 zmp-1 vulA
vulE
vulD
adult
L4 larva
WBPaper00013312
syIs69 [zmp-1::pes-10::cfp] CFP PS3668 V Expr2357 zmp-1 vulA
vulE
vulD
adult
L4 larva
WBPaper00013312
syIs76 [zmp-1::pes-10::cfp] CFP PS3721 IV Expr2357 zmp-1 vulA
vulE
vulD
adult
L4 larva
WBPaper00013312
syIs77 [zmp-1::pes-10::yfp] YFP PS3728
PS3997
II Expr2357 zmp-1 vulA
vulE
vulD
adult
L4 larva
WBPaper00013312
syIs80 [lin-11::gfp; unc-119(+)] GFP DY164
PS3808
III Expr2574 lin-11 vulC
head neuron
proct
ventral cord neuron
vulA
uterine toroidal epithelial cell
vulF
vulE
vulD
vulB2
tail neuron
vulB1
adult
L4 larva
WBPaper00005954
syIs802 [myo-2::GFP] GFP PS9391 X
syIs803 [myo-2:gfp, daf-4(+)] GFP PS9392 II
syIs804 [myo-2:gfp, daf-4(+)] GFP PS9393 X
syIs807 [myo-2:gfp, daf-4(+)] GFP PS9396 IV
syIs90 [egl-17::yfp] YFP PS3972 III Expr2354 egl-17 vulC
vulF
vulE
vulD
L3 larva
L4 larva
WBPaper00013312
syIs91 [egl-17::yfp] YFP PS3973 III Expr2354 egl-17 vulC
vulF
vulE
vulD
L3 larva
L4 larva
WBPaper00013312
syIs99 [egl-17::yfp] YFP PS4135 II Expr2354 egl-17 vulC
vulF
vulE
vulD
L3 larva
L4 larva
WBPaper00013312
teIs18 [sdz-23::gfp-H2B] GFP TX585 V Expr3643 sdz-23 Ea
Ep
E
WBPaper00026704
teIs3 [med-1::gfp-pop-1] GFP TX300
TX932
I
teIs46 [end-1::gfp-H2B] GFP TX691 IV
tnIs13 [pie-1::vab-1::gfp; unc-119(+)] GFP DG2102
DG2160
DG2189
DG2190
V Expr8095 vab-1 WBPaper00031867
trIs30 [(him-4p::MB::YFP; hmr-1b::DsRed2; unc-129neural-specific promoter::DsRed2]. RP247 trIs30 I was constructed by microinjecting pPRRF138.2(him-4p::MB::YFP), pPRZL44(hmr-1b::DsRed2) and pPR2.1(unc-129neural-specific promoter::DsRed2) together at 10, 80 and 40 ng/ul, respectively, into N2 (wild-type) adults. DsRed2, YFP RP247 I Marker8 him-4 WBPaper00025227
tyIs4 [egl-13::gfp] transcriptional fusion. A strain containing the tyIs4 integrated chromosomal array was generated by injecting an egl-13::GFP transcriptional gene fusion (pWH17) into N2 and subjecting transmitting extra-chromosomal lines to gamma-irradiation; homozygous integrants were then selected. tyIs4 was mapped to chromosome III. GFP III Expr4977 egl-13 uterine seam cell WBPaper00031111
uIs10 [mec-9::lacZ] LacZ X Expr268 mec-9 PVDR
touch receptor neuron
PVDL
head neuron
ventral cord neuron
WBPaper00002379
uIs22 [mec-3::gfp] GFP TU2562 V
uIs5 [deg-1::lacZ] LacZ X Expr223 deg-1 anal depressor muscle
IL1 neuron
PVCL
AVDL
PVCR
AVDR
AVG
body wall musculature
all stages WBPaper00002711
uIs6 [deg-1::lacZ] LacZ X Expr223 deg-1 anal depressor muscle
IL1 neuron
PVCL
AVDL
PVCR
AVDR
AVG
body wall musculature
all stages WBPaper00002711
uIs9 [mec-2::gfp] GFP V
urIs13 [unc-119::gfp; pRF4]. IM#175 is the plasmid construct of unc-119::gfp. GFP IM39
IM146
IM62
IM98
IM65
IM19
IM117
IM167
IV
veIs13 [col-19::gfp]. Integrated transgenic line containing translational fusion of col-19 first 7 amino acids with GFP. GFP RG365
GR1444
GR1445
GR1429
V Expr508 col-19 hypodermis adult WBPaper00003119
vsIs103 [HSN::SNB-1-GFP-DsRed2] GFP LX998
LX967
X
vsIs108 [HSN::UNC-13S-GFP-DsRed2] GFP LX993 III
vsIs13 [pes-10::gfp]. A 500 bp VC enhancer fragment from lin-11 amplified by the primers 5 -GACCGCATGCGTGGTGTAATCTGATCTG and 5'-GAGAAGGCCTTGCTCTATTCAATCATCC cloned upstream of the basal pes-10 promoter and the GFP coding sequences in the vector pPD97.78 vector. GFP LX959 IV Marker4 VC neuron WBPaper00006049
vsIs49 [HSN::GOA-1(Q205L)] LX940 V
vsIs50 [HSN::S1 subunit of PTX] S1 subunit of PTX LX850 X
vsIs56 [HSN::EGL-30(Q205L)] LX895
LX884
X
vtIs1 [dat-1::gfp; rol-6] transcriptional fusion. GFP OH4041
OH4224
OH4226
OH4240
OH4247
OH4254
OH4265
OH4271
OH4274
OH4276
OH4277
OH4299
OH4303
OH4305
OH4306
OH4307
OH4320
OH4322
OH4334
OH4335
OH4339
OH6071
OH6072
OH6086
OH6087
OH7007
OH7008
OH7016
OH7058
OH7095
OH7098
OH7118
OH7150
OH7323
BY200
V Marker1 dat-1 WBPaper00005147
wIs1 [SCM::nls-lacZ; rol-6(su1006)] Seam cell specific promoter driving LacZ expression. LacZ JR125 IV Marker23 seam cell embryo WBPaper00002772
wIs54 [ajm-1::gfp] seam cell specific promoter drives GFP expression. GFP GR1425
GR1434
GR1430
GR1435
JR672
V
wIs78 [ajm-1::gfp; scm-1::gfp; unc-119(+); F58E10(+)] GFP JR1000
RG733
RG734
X
wIs84 [elt-2::gfp] GFP JR1838
JR1130
X
wdIs1 [unc-4::lacZ] LacZ III Expr337 unc-4 AVFR
I5
DA neuron
VC neuron
AVFL
SAB
VA neuron
WBPaper00002281
wdIs3 [del-1::gfp] GFP NC138 X Expr2330 del-1 SABVR
VB1
VB2
SABVL
VA neuron
adult
L2 larva
L3 larva
L4 larva
WBPaper00003757
wxIs29 [ram-5::gfp, rol-6(su1006)] GFP KC69 I
xtIs24 [unc-18::mCherry Cbr-unc-119(+)] mCherry UZ566 V
xtIs25 [unc-18::mCherry Cbr-unc-119(+)] mCherry UZ567 II
xtIs31 [unc-18::mCherry Cbr-unc-119(+)] mCherry UZ557 II
xtIs32 [unc-18::mCherry Cbr-unc-119(+)] mCherry UZ558 II
yIs16 [hsp::sdc-3(+)], transcriptional fusion, provide sdc-3 transcripts upon heat shock. X
yIs19 [sdc-3::lacZ], transcriptional fusion, balancer for sdc-2. LacZ X
yIs2 [xol-1::lacZ]. Translational fusion. LacZ TY1774
TY1775
IV Expr1540 xol-1 comma embryo
gastrulating embryo
enclosing embryo
bean embryo
WBPaper00002107
yIs29 [dpy-30::sdc-2]. To create the dpy-30::sdc-2 transgene, a BglII site we introduced at the fourth codon of sdc-2 and an 11-kb BglIIKpnI sdc-2 fragment was subcloned into the Bcl I and Kpn I sites of pTY647, a plasmid containing the dpy-30 minimal rescuing region. The resulting transgene, pTY975, included the dpy-30 promoter, the first three codons of dpy-30, a leucine codon, and the entire sdc-2 structural gene beginning with its fifth codon. pTY975 was then injected with the transformation marker p76-16B [unc-76(+)]into him-8(e1489); unc-76 hermaphrodites and established transmitting lines. Extrachromosomal arrays bearing pTY975 were stably integrated into the genome by Gamma-irradiation for 15 min. Five independent integrated lines were isolated, including yIs29 on X and yIs30. X
yIs3 [HA::SDC-3], provide excess sdc-3. V
yIs33 [xol-1::lacZ] LacZ TY2438
TY2439
III
yIs4 [HA::SDC-3], provide excess sdc-3. X
yIs58 [myo-2::gfp; ceh-39(+)] GFP IV
ybIs736 [myo-3::EGL-15BGAR] BGAR X
ynIs12 [snb-1::apl-1] III
ynIs13 [snb-1::apl-1] V
ynIs21 [flp-3::gfp] GFP V Expr3005 flp-3 IL1 neuron
PQR
CP9
[1]
WBPaper00024197
ynIs22 [flp-8::gfp] GFP III Expr3010 flp-8 AUAR
ADAL
RMGL
PVM
ADAR
CP9
AUAL
URXR
URXL
RMGR
WBPaper00024197
ynIs24 [flp-5::gfp] GFP V Expr3030 flp-5 R7BR
R5BR
R1BR
R7BL
R5BL
R1BL
WBPaper00006506
ynIs25 [flp-12::gfp] GFP II Expr3013 flp-12 R4AR
SAAVR
R7BR
R5AL
R4BR
PVR
R4AL
SAAVL
PDA
AVJL
R7AR
R1AL
SMBDR
R5BR
BDUL
BAGL
SAADL
CP9
R4BL
R1BR
AVHL
SDQL
SAADR
R1AR
SMBVR
SDQR
R7AL
SMBVL
AVHR
R7BL
AVJR
BDUR
SMBDL
R5AR
BAGR
R5BL
R1BL
WBPaper00024197
ynIs26 [flp-12::gfp] GFP I Expr3013 flp-12 R4AR
SAAVR
R7BR
R5AL
R4BR
PVR
R4AL
SAAVL
PDA
AVJL
R7AR
R1AL
SMBDR
R5BR
BDUL
BAGL
SAADL
CP9
R4BL
R1BR
AVHL
SDQL
SAADR
R1AR
SMBVR
SDQR
R7AL
SMBVL
AVHR
R7BL
AVJR
BDUR
SMBDL
R5AR
BAGR
R5BL
R1BL
WBPaper00024197
ynIs30 [flp-4::gfp] GFP NY2030 I Expr3006 flp-4 ADLR
PHAR
ADLL
PVDR
I5
AWCR
FLPR
PVDL
ASEL
AWCL
PHAL
PHBR
PHBL
NSMR
AVM
I6
FLPL
NSML
WBPaper00024197
ynIs34 [flp-19::gfp] GFP IV Expr3018 flp-19 AINL
HSNR
R9AR
R7BR
R5AL
AWAL
CEMVR
R7AR
CEMVL
R5BR
BAGL
tail
CEMDL
R9BL
AINR
URXR
R7AL
URXL
R9BR
CEMDR
AWAR
R7BL
R9AL
R5AR
BAGR
HSNL
R5BL
WBPaper00024197
ynIs37 [flp-13::gfp] GFP NY2037 III Expr3014 flp-13 m3R
ASGL
I5
ASKL
DD neuron
m3L
M5
BAGL
ASEL
spicule protractor muscle
ASGR
ASKR
ASER
BAGR
WBPaper00024197
ynIs37 [flp-13::gfp] GFP NY2037 III Expr7935 flp-13 ASEL
ASER
neuron
WBPaper00030829
ynIs38 [flp-13::gfp] GFP V Expr3014 flp-13 m3R
ASGL
I5
ASKL
DD neuron
m3L
M5
BAGL
ASEL
spicule protractor muscle
ASGR
ASKR
ASER
BAGR
WBPaper00024197
ynIs40 [flp-11::gfp] GFP NY2040 V Expr3012 flp-11 R4AR
AUAR
PVCL
R4BR
VD neuron
R4AL
SABVR
uv1
DD neuron
DA neuron
BAGL
PVCR
R4BL
head muscle
SABVL
AUAL
PHCL
DVB
URXR
socket cell
PHCR
URXL
LUAR
SABD
LUAL
BAGR
WBPaper00024197
ynIs41 [flp-11::gfp] GFP I Expr3012 flp-11 R4AR
AUAR
PVCL
R4BR
VD neuron
R4AL
SABVR
uv1
DD neuron
DA neuron
BAGL
PVCR
R4BL
head muscle
SABVL
AUAL
PHCL
DVB
URXR
socket cell
PHCR
URXL
LUAR
SABD
LUAL
BAGR
WBPaper00024197
ynIs45 [flp-15::gfp] GFP NY2045 I Expr3015 flp-15 pharyngeal muscle cell
PHAR
PHAL
I2L
I2R
socket cell
neuronal sheath cell
WBPaper00024197
ynIs49 [flp-5::gfp] GFP NY2049 V Expr3007 flp-5 pharyngeal muscle cell
R7BR
R5AL
P8
PVT
RMGL
R7AR
R1AL
HOB
R5BR
ASEL
I2L
R1BR
I2R
R1AR
I4
R7AL
RMGR
R7BL
M4
R5AR
ASER
R5BL
R1BL
WBPaper00024197
ynIs50 [flp-22::gfp] GFP NY2050 IV Expr3021 flp-22 AVAL
PVWL
SMDDL
RICR
AVAR
PVWR
CEPVR
PVDR
ASGL
URADR
uv1
PVDL
URAVL
AIMR
AVL
SMDVL
AIZR
RICL
CEPDR
SMDDR
ASGR
CEPVL
AVG
AIZL
URAVR
RIVR
CP neuron
CEPDL
SMDVR
AIML
URADL
RIVL
WBPaper00024197
ynIs51 [flp-22::gfp] GFP III
ynIs52 [flp-5::gfp] GFP V Expr3007 flp-5 pharyngeal muscle cell
R7BR
R5AL
P8
PVT
RMGL
R7AR
R1AL
HOB
R5BR
ASEL
I2L
R1BR
I2R
R1AR
I4
R7AL
RMGR
R7BL
M4
R5AR
ASER
R5BL
R1BL
WBPaper00024197
ynIs53 [flp-20::gfp] GFP IV Expr3019 flp-20 AIBL
PVCL
PVR
RIBR
PVT
PVM
PLMR
ALMR
ASEL
AIBR
PVCR
RIBL
ALML
AVM
LUAR
PLML
LUAL
ASER
WBPaper00024197
ynIs54 [flp-20::gfp] GFP NY2054 V Expr3019 flp-20 AIBL
PVCL
PVR
RIBR
PVT
PVM
PLMR
ALMR
ASEL
AIBR
PVCR
RIBL
ALML
AVM
LUAR
PLML
LUAL
ASER
WBPaper00024197
ynIs57 [flp-2::gfp] GFP NY2057 III Expr3004 flp-2 PVWL
ASIR
PVWR
I5
MCL
head muscle
AIAR
AIAL
RID
ASIL
M4
MCR
WBPaper00024197
ynIs58 [flp-15::gfp] GFP X Expr3015 flp-15 pharyngeal muscle cell
PHAR
PHAL
I2L
I2R
socket cell
neuronal sheath cell
WBPaper00024197
ynIs64 [flp-17::gfp] GFP NY2064 I Expr3016 flp-17 R7BR
R5AL
R7AR
R1AL
M5
R5BR
BAGL
R1BR
R1AR
R7AL
R7BL
R5AR
BAGR
R5BL
R1BL
WBPaper00024197
ynIs64 [flp-17::gfp] GFP NY2064 I Expr3033 flp-17 R7BR
R5BR
R1BR
R7BL
R5BL
R1BL
WBPaper00006506
ynIs66 [flp-7::gfp] GFP NY2066 IV Expr3009 flp-7 SAAVR
PVWL
RICR
PHAR
PVWR
ALA
SAAVL
PDA
SMDVL
SAADL
RICL
PHAL
PHBR
SAADR
PHBL
AVG
RMDVR
SMDVR
RMDVL
WBPaper00024197
ynIs67 [flp-6::gfp] GFP NY2067 III Expr3008 flp-6 R7BR
R5AL
R2BL
ASGL
PVT
R7AR
R2AL
R5BR
R2BR
ASEL
AFDL
I1L
R6AR
AFDR
ASGR
R6BL
R7AL
R6AL
R6BR
R7BL
R2AR
R5AR
ASER
I1R
R5BL
WBPaper00024197
ynIs67 [flp-6::gfp] GFP NY2067 III Expr3031 flp-6 R7BR
R2BL
R5BR
R2BR
R6BL
R6BR
R7BL
R5BL
WBPaper00006506
ynIs79 [apl-1::APL-1-GFP] GFP V
ynIs82 [flp-12::gfp] GFP NY2082 III Expr3013 flp-12 R4AR
SAAVR
R7BR
R5AL
R4BR
PVR
R4AL
SAAVL
PDA
AVJL
R7AR
R1AL
SMBDR
R5BR
BDUL
BAGL
SAADL
CP9
R4BL
R1BR
AVHL
SDQL
SAADR
R1AR
SMBVR
SDQR
R7AL
SMBVL
AVHR
R7BL
AVJR
BDUR
SMBDL
R5AR
BAGR
R5BL
R1BL
WBPaper00024197
ynIs86 [apl-1(+)] X
ysIs42 [punc-4::snb-1::GFP; lin-15+] GFP NM670 X
yzIs71 [tph-1::gfp; rol-6(d)] GFP GR1333 V
zIs356 [daf-16::daf-16-gfp; rol-6] GFP TJ356 IV
zcIs13 [hsp-6::gfp] GFP SJ4100 V
zcIs19 [ubl-5::gfp] GFP SJ4151 X Expr4516 ubl-5 intestine
pharynx
WBPaper00027723
zcIs22 [ubl-5Cb::gfp] GFP SJ4153 I
zcIs39 [dve-1::dve-1-gfp] translational fusion expressing DVE-1 fused to GFP at its C-terminal residue 468. GFP SJ4197 II
zcIs4 [hsp-4::gfp] translational fusion with 1.1 kb of genomic DNA immediately 5' upstream of ATG amplified by PCR and ligated in-frame with GFP in pPD95.75. GFP SJ6
SJ17
SJ30
SJ4005
V Expr3927 hsp-4 intestine L1 larva
adult
L2 larva
L3 larva
L4 larva
WBPaper00027660
zcIs4 [hsp-4::gfp] translational fusion with 1.1 kb of genomic DNA immediately 5' upstream of ATG amplified by PCR and ligated in-frame with GFP in pPD95.75. GFP SJ6
SJ17
SJ30
SJ4005
V Expr3928 cid-1 intestine L1 larva
adult
L2 larva
L3 larva
L4 larva
WBPaper00027660
zcIs40 [dve-1::dve-1-Myc3-His6, myo-3::gfp] GFP SJ4199 X
zcIs8 [abu-1::gfp] translational fusion. The promoter and coding region of abu-1 was ligated in frame with GFP to produce abu1::abu-1::gfp(ZcEx8) strain. A 1.3-kb fragment of C. elegans genomic DNA immediately 5' of the predicted initiation ATG codon of abu-1 (AC3.3) was amplified by PCR using the oligonucleotides AC3.1S (5' -GGCATTGTGGCACGCATTGAACTG-3') and AC3Bam.2AS (5'-GATAGGATCCATTGTTAATATGCTTGAAGAGCTGC-3') and ligated in frame with the GFP coding region in the plasmid of pPD95.75. The abu-1::gfp(zcEx8) strain was created by coinjecting the ac3.3.pPD95.75 plasmid (25 ug/ml) with a lin-15 rescuing plasmid, pSK1 (25 ug/ml), into lin-15(n765ts) strain. The extrachromosomal array was integrated into the chromosome with ultraviolet/trimethylpsoraren treatment, yielding the abu-1::gfp(zcIs8)X reporter strain. GFP X Expr2206 abu-1 pharynx WBPaper00005432
zcIs9 [hsp-60::gfp] GFP SJ4058 V
zdIs1 [ceh-23::GFP, lin-15(+)] GFP IV
zdIs10 [odr-2::cfp] CFP MT4010 V
zdIs13 [tph-1::gfp] transcriptional fusion. GFP OH4127
OH4134
OH4135
OH4138
OH4143
OH4144
OH4147
OH7235
OH7236
OH7237
OH7251
OH7253
OH7260
OH7261
OH7262
OH8014
OH8015
OH8016
MT4013
IV Expr8142 tph-1 HSNR
pharyngeal muscle cell
ADFL
NSMR
ADFR
nerve ring
HSNL
NSML
L1 larva
adult
L2 larva
L3 larva
L4 larva
fully-elongated embryo
elongating embryo
WBPaper00031671
zdIs15 [lsm-6::gfp; lin-15(+)] GFP MT4015 V Expr2638 lsm-6 vulval muscle
gonadal sheath cell
body wall musculature
uterine muscle
gon_herm_dtc_P
gon_herm_dtc_A
adult hermaphrodite WBPaper00006281
zdIs21 [zag-1::gfp] GFP OH4141
MT4021
IV
zdIs3 [glr-1::gfp] GFP MT4003 IV
zdIs31 [dat-1::gfp] GFP X
zdIs4 [mec-4::gfp, lin-15(+)] GFP SK4005 IV
zdIs42 [unc-129::gfp] GFP MT4042 IV
zdIs45 [mgl-2::gfp] GFP II
zdIs5 [mec-4::GFP] GFP HS1680
IC136
IC156
IC400
NG4370
SK4005
TL24
ZB154
MT4005
I Marker71 mec-4 AVM WBPaper00031651
zdIs5 [mec-4::GFP] GFP HS1680
IC136
IC156
IC400
NG4370
SK4005
TL24
ZB154
MT4005
I Marker72 mec-4 touch receptor neuron WBPaper00032072
zfIs1 [tdc-1::gfp, lin-15(+)] GFP QW2 I
zhIs4 GFP AH142 III Expr801 lip-1 P8.p
P3.p
P5.p
P6.p
P7.p
hyp7 syncytium
P4.p
all stages WBPaper00004542
zuIs6 [end-1::actin-gfp, unc-119(+)] GFP X