Search results
From WormBaseWiki
Jump to navigationJump to searchCreate the page "Contained in and Contains" on this wiki! See also the search results found.
- ...w the elements’ relationships. This complex and intricate network of items and their classes form the structure of the main data model. ...he subclasses. Numbers next to each name are the number of items contained in the class/subclass.1 KB (209 words) - 03:18, 13 November 2018
- The new model has removed the In_book tag, since the existing Contains and Contained_in tags can handle this relationship. All books will now get their own WBPaper ID, instead of WBPapernnnnnnnn.n, and Type Book, Status Valid.15 KB (1,605 words) - 23:38, 13 August 2010
- Maintaining Perl modules across our server farm can be a time consuming and tedious task because of the heterogeneity of our setup. Further, we often ...e System configuration, then the mirror option, custom, and as above. Save and quit.6 KB (868 words) - 18:47, 13 April 2015
- ...we need a training set that is homogeneous, at least in terms of enzymatic and transporter activity. ...tivity' but do not clone the gene. These papers would be SVM positive for in vitro training, but are not curatable.1 KB (178 words) - 00:04, 2 February 2011
- ...WormBase data model|About the WormBase data model]] - ''how data is stored and structured at WormBase'' #[[AceDB classes tutorial|AceDB classes tutorial]] -''Examples and descriptions of commonly accessed classes at WormBase''2 KB (264 words) - 01:36, 1 April 2022
- ...a server-class machine. This requires significant time and effort upfront, and some time every few weeks to keep things up-to-date. ...(Linux, Windows) or the VMWare Fusion Player (Mac) available from VMWare. In essence, one runs a complete operating system complete with WormBase INSIDE2 KB (281 words) - 17:30, 16 August 2010
- ! This is supplemental methods that describe how they identified lesions and contained a Table about temperature-sensitive phenotypes.. ! Fig. S7 shows molecular nature of deps-1 alleles, but not sequenced in this paper.2 KB (301 words) - 18:05, 16 August 2010
- ...S253.bb) which contained each of the transcripts with exon start positions and lengths. not there now. user was Updating transcript bed file for CeNDR = Agenda and Minutes=2 KB (299 words) - 16:04, 20 May 2021
- Data modules are self-contained packages of individual datasets. This are shipped as virtual disks for use Users can mix-and-match data modules. And since many modules change only infrequently, this minimizes the size of fil2 KB (261 words) - 18:27, 11 August 2010
- The BioPerl library provides a simple relational schema and database access layer for querying genomic features. This is the access met ...access to the MySQL database of genome features (although this may change in the future). You must:11 KB (1,663 words) - 17:45, 16 August 2010
- ...d Search option. This expands the search to include full text of all paper and meeting abstracts. SEARCH WITH THE WILD CARD (*) ...r any objects that contain the key word glp. When searching for "Anything" in WS97, this particular search produces 394 objects.2 KB (399 words) - 18:32, 17 August 2010
- = Logging in as admin = Find the admin account username and password by executing this search in your wormbase.org account:15 KB (2,088 words) - 16:16, 15 October 2020
- New release of WormBase WS179, Wormpep179 and Wormrna179 Mon Jul 30 12:21:01 BST 2007 ii) models.wrm.WS179 - the latest database schema (also in above database files)8 KB (843 words) - 10:53, 21 December 2011
- <pre>New release of WormBase WS107, Wormpep107 and Wormrna107 Fri Aug 8 13:44:00 BST 2003 ii) models.wrm.WS107 - the latest database schema (also in above database files)6 KB (659 words) - 11:17, 21 December 2011
- | align="center" style="background:#f0f0f0;"|'''Linked Term in Abstract''' | align="center" style="background:#f0f0f0;"|'''Linked Term in GO'''29 KB (4,227 words) - 18:16, 21 September 2011
- Script takes as input the gp_association.wb and the gp2protein.wb files and converts the UniProtKB file to a .ace file for upload to citace. and that should work. If it doesn't we can remove the Date_last_updated from t6 KB (894 words) - 18:00, 11 November 2013
- ...ntences to a curation form, make annotations, and download the annotations in either a simple three-column format or the GO's gene_association file (GAF) Curators would be able to search Textpresso using their chosen criteria and export the sentences to the CCC curation form.17 KB (2,749 words) - 20:04, 21 January 2011
- * Reviewer's response and eventual Author's corrections ...n: biology instead of Wormbase in the publisher field (as opposed as shown in the screenshot)9 KB (1,391 words) - 19:47, 19 April 2023
- *Other filtering steps may be introduced in the future (e.g., specific proteins like DAF-16 or sentences that also cont ...>chromosomes</localization_cell_components_2011-02-11> in maturing oocytes and is <localization_experimental_082208>widely</localization_experimental_082211 KB (1,666 words) - 17:53, 19 June 2014
- "Virtual Machines" (or VMX) are self-contained packages of everything you need to use WormBase locally Virtual machines can be "played" on Mac, Windows, and Linux platforms using the free [http://www.vmware.com/products/player/ VMPl11 KB (1,664 words) - 18:43, 17 August 2010
- ...a search on all papers in the Textpresso for Arabidopsis corpus published in 2008. '''After the initial trial run, Tanya realized that there are papers included in the corpus that describe experiments from other organisms that would not li24 KB (3,814 words) - 18:31, 8 August 2011
- First two items cover general tool and website feature requests. Then, curation pipelines for each datatype ...line description'', ''postgres query'', ''requests'', ''false positives'' and ''false negatives''.17 KB (2,401 words) - 22:36, 29 November 2017
- ...are also part of the broader plan for Textpresso-based curation pipelines and the GO's Common Annotation Framework. #Recording curator or group and date of search30 KB (4,868 words) - 14:50, 11 June 2013
- =='''Methods and Strategies for Annotation'''== ...ators can query and sort the list according to reference count, gene name, and curation status.13 KB (1,830 words) - 16:40, 13 December 2012
- see [[Citing and Acknowledging WormBase|Citing and Acknowledging WormBase]]<br> ...ACeDB can be accessed both remotely and locally, through both commandline and web server.67 KB (10,954 words) - 09:22, 19 February 2013
- ...the system is configured correctly, you should not need to be a root user in order to update the site. <nowiki>*** Potential stumbling blocks are indented and hilighted with a34 KB (5,450 words) - 18:24, 17 August 2010
- 3. check "antibody" and "str flags cur_strdata" The string matching pipeline will run on a daily cronjob and will process 50 paper per day.21 KB (2,888 words) - 19:58, 9 April 2021
- =List of Paper Tables in Postgres (Alphabetical)= Contains the affiliation (location) of one or more authors of the paper, meeting abs25 KB (3,238 words) - 16:42, 8 November 2019
- ''This document describes how to install and configure the Intermine instance at WormBase. <span style="color: red">'''Work towards staging and production should be carried out as "intermine" user (<code>sudo su - inter25 KB (3,652 words) - 23:06, 25 December 2014
- The following attributes are unused in the current Datomic-based DB prototype. It seems likely that many of them | :analysis/species-in-analysis35 KB (4,174 words) - 10:52, 2 February 2015
- **Documenting elements of WormBase workflow to ease transition for new staff and keep track of changes made **Added diagram and explanation for Tools data loading29 KB (4,254 words) - 20:25, 27 April 2012
- ...me take collaborative notes on this session! Fill out your name in the box in the top right-hand corner. Add yourself to the editors list, then edit away .... In addition, the experimental analysis showed our approaches were robust in both the two tasks.25 KB (3,541 words) - 19:14, 11 April 2014
- ...-6 untilizes different modes of splicing, see primer extension experiments in the article. ||2/2/02 21:01 | 2050||cdNA for unc-51 was isolated and sequenced but accession number was not given. ||2/2/02 21:0140 KB (4,083 words) - 23:02, 13 August 2010
- ...and V2R (CGGGGTACCAGATAAGCGACGCAGGCGGTTGGGAC), containing engineered XmaI and KpnI sites, using cosmid DNA (C42D8) as a template. V2B3, at 50 ug/ml, was ...d the SpeI fragment of pAZ132 bearing unc-119(+) and pie-1::gfp sequences, and bombardment of the ligated DNA into unc-119(ed3) worms. || GFP || [http://w397 KB (64,724 words) - 09:57, 7 July 2020
- ...We provide links to other databases that deal with these molecule entities in greater detail. ** metabolite (primary and secondary)50 KB (6,966 words) - 19:15, 13 August 2020
- ...sion data from the literature and individual laboratories and display them in the WormBase gene expression page. ...oral or spatial (e.g., tissue, subcellular, etc.) localization of any gene in a wild-type background with different data types120 KB (19,719 words) - 16:44, 20 October 2023