WormBase Model:Construct

Proposed model changes

Purpose: the technology of engineering mutations and gene replacement has been developed in C. elegans. With these new research tools, capture and display of the molecular information of these alleles needs to be updated. We propose a new class, Construct, to capture the specifics of the DNA tool used to perform the replacement or engineering, while the Variation model gets updated to record the engineering event itself and its impact on the genome. As a side benefit to the creation of the Construct model, we can use this new class to also capture the genomic arrays used create transgenes.

Variation

?Variation
Variation_type 
Engineered_allele 
Variation_summary //to house final engineered construct
    Derived_from ?Construct XREF Variation
Method 
    Homologous_recombination 
    NHEJ
    MosSci
    Cas9
    Crispr
Expr_pattern ?Expr_pattern XREF Variation #Evidence

notes on variation model changes

NOTE: the variation model currently has the following tags

• Nature_of_variation UNIQUE
  • Polymorphic //would this be complex fusions and chimeras?
  • Synthetic //Would this be simple fusions

Do you know what these were intended for? Could they be used to house engineered alleles?�

Construct (new)

?Construct 
Summary   ?Text
Sequence feature ?Feature XREF Construct
Gene ?Gene
Gene_site_targeted ?SO_term    
Fusion_reporter ?Text //fluorescent proteins GFP, RFP, mCherry, etc.
Other_reporter ?Text //to add reporters, tags that aren’t included in model
Purification_tag ?Text //FLAG, HA, Myc, TAP, etc.  
Type_of_construct
    Chimera
    Domain_swap
    Engineered mutation
    Fusion
Complex // complex changes (e.g. GFP fusion plus point mutations)  
        Transcriptional_fusion
Translational_fusion 
N-terminal_translational_fusion
C-terminal_translational_fusion
Internal_coding_fusion
Selection_marker     ?Text    //for unc-119(+), lin-15(+), drug selection
Construction_summary  ?Text    //Backbone vector, mol bio 
Used_for
    Transgene_construction ?Transgene XREF Construct
    Variation ?Variation XREF Engineered_allele    
Reference ?Paper XREF Construct  
Person ?Person XREF Construct
Laboratory ?Laboratory #Lab_Location 
Remark ?Text #Evidence

notes on construct model

Chris’ thoughts: We could add a tag to capture the entire DNA sequence of the object (DNA_text or something). Maybe we could also add a Species tag to capture which species’ sequences are incorporated. As per our discussion at group meeting, I think it would ultimately be good to distinguish sequences/features that drive transcription (e.g. promoter sequences, enhancers, etc.) from those that direct post-transcriptional regulation (3’ UTRs) and non-regulatory (backbone) sequences. This way ?Expr_pattern, for example, can pull the relevant sequence/feature info from the ?Construct object.

dealing with precise ends

For mapping constructs to the genome - mainly for expression, but should also be used for rescuing constructs

Notes and thoughts for incorporation of precise ends objects into the construct class (Daniela):

We have approx 1000 objects with precise ends 'tags'.

Annotations have sometimes murky boundaries for sequences, especially very old annotations. no primer info. e.g.: Expr1265: All construct contains 3kb of 5'UTR. dys-1::gfp VIII: 3'end in exon 5. Other constructs end at exon 1 or 3. --precise ends.

Expr1275: [clk-1::gfp] translational fusion with clk-1 coding region and upstream gene toc-1 and 624bp 5' of the toc-1 start region. --precise ends no info on where the construct ends. Presumably stop codon?

Expr1049: [rgs-2::gfp] translational fusion. GFP reporter construct was constructed by inserting genomic DNA fragments from rgs-2 into the vector pPD95.67. The construct contained the promoter regions and 5' coding sequences of the RGS gene, such that a coding exon for the gene was fused in frame to the coding sequence for GFP. The rgs-2 transgene contained sequences from -4770 to +3592 (relative to the rgs-2 translation start), and thus included the large first intron of rgs-2. --precise ends.

They don't specify the promoter region. How can we map precisely to the sequence?

Issue of sequence coordinates varying with gene models. Something published 10 years ago should be remapped. Worth it? To cite Paul D: “..you need to establish what release of the database the data was generated against or have some other form of identifying how to correct the drift, once you can do that we can transform the coordinates forward if they are a large batch else you would have to do it manually.”

incorporating sequence features

examples:

Expr_pattern	Feature	Reporter gene	Notes
Expr11274	Feature : "ceh-13.enh450" WBsf919527	enh450 (23256 to 26172) was amplified by PCR using primers RP3Cel.H.do and RP3Cel.H.up for cloning into pMF1DH3 (pRK24) or pPD107.94 (pRK23), and primers RP3D.K.up and RP3D.B.do for cloning into pCb.	Could define ceh-13.enh450::pMF1DH3 or ceh-13.enh450::pPD107.94.  In this case in the construct model you need the WBsf -Feature-ceh-13.enh450- and the clone pMF1DH3 and pPD107.94
Expr11275	Feature : "ceh-13.enh3.4" WBsf919526	enh3.4 (nucleotide positions 23256 to 26644) was cut from pMF1 for cloning into pPD107.94 (pASF43), or PCR amplified using primers 3.3up and 3.3down for cloning into pCb.	Could define ceh-13.enh3.4::pPD107.94. In this case in the construct model you need the WBsf -Feature-13.enh3.4- and the clone PD107.94 
Expr11276	Feature : "ceh-13.enh740" WBsf919528	enh740 (nucleotide positions 24001 to 26644) was PCR amplified using primers CCCAAGCTTTCAGATCCCTCCACATGTC and TCTGGTAGACTGTGCAAGCAAC for cloning into pPD107.94 (pRK29) or primers GGGGTACCTCAGATCCCTCCACATGTC and CGGGATCCTGGATCTTAGGGAATTGTGG for cloning into pCb.	Could define ceh-13.enh740::pRK29 and ceh-13.enh740::pCb.  In this case in the construct model you need the WBsf -Feature-ceh-13.enh740::pRK29- and the clone pRK29 and pCb 
Expr11277	Feature : "ceh-22.proximal"	ceh-22.proximal::(del)Pes-10::lacZ.	Could define ceh-22.proximal::(del)Pes-10::lacZ.
Expr11278	Feature : "ceh-22.PE1"	WBTransgene00019185. [PE1::(del)pes-10::lacZ]	In the construct model you need the WBsf -ceh-22.PE1- and the clone pPD95.21 ((del)Pes-10::lacZ).
Expr11279	Feature : "ceh-22.pe39_pe41"	WBTransgene00018710, WBTransgene00018711. [pe39::(del)pes-10::lacZ], [pe41::(del)pes-10::lacZ]	In the construct model you need the WBsf -ceh-22.pe39_pe41- and the clone pPD95.21 ((del)Pes-10::lacZ).
Expr11280	Feature : "ceh-22.pe27"	WBTransgene00019186 ( WBTransgene00019186 ). [pe27::(del)pes-10::lacZ]	In the construct model you need the WBsf -ceh-22.pe27- and the clone pPD95.21 ((del)Pes-10::lacZ).
Expr11281	Feature : "ceh-24.vulval"	The DNA sequence from Feature"ceh-24.vulval" was assayed upstream of a truncated pes-10 promoter fragment driving lacZ -pPD95.18.	Could define ceh-24.vulval::pPD95.18. In this case in the construct model you need the WBsf -ceh-24.vulval- and the clone pPD95.18. 
Expr11282	Feature : "ceh-24.pm8"	The DNA sequences from Feature"ceh-24.pm8" was assayed in front of a truncated myo-2 promoter -pPD95.62.	Could define ceh-24.pm8::pPD95.62. In this case in the construct model you need the WBsf -ceh-24.pm8- and the clone pPD95.62. 
Expr11283	Feature : "egl-17.vulDC"	A 64-bp fragment, located between 366 and 303 bp upstream of the egl-17 ATG was inserted into the pPD122.53 vector, which contains the minimal pes-10 promoter.	Could define: [Feature-egl-17.vulDC::pPD122.53]. In this case in the construct model you need the WBsf -Feature-egl-17.vulDC- and the clone pPD122.53 
Expr11284	Feature : "egl-17.distal"	Distal enhancer inserted into the pPD122.53 vector, which contains the minimal pes-10 promoter.	Could define: [egl-17.distal::pPD122.53]. In this case in the construct model you need the WBsf -Feature-egl-17.distal- and the clone pPD122.53 
Expr11285	Feature : "egl-17.proximal"	Proximal enhancer inserted into the pPD122.53 vector, which contains the minimal pes-10 promoter.	Could define: [egl-17.proximal::pPD122.53]. In this case in the construct model you need the WBsf -Feature-egl-17.proximal- and the clone pPD122.53 
Expr11335	Feature : "ges-1.WGATAR"	Six or seven copies of WGATAR sites in either orientation were inserted into the test vector pJM77. The vector pJM77 used to test the enhancer activity of candidate sequences was constructed as follows: a 446-bp Sau3A fragment from the promoter of the C. elegans heat shock gene 16–48 was isolated from plasmid pPC16.48-1 (Stringham et al., 1992) and inserted in the correct orientation into BamHI-cleaved vector pPD96.04 (kindly provided by A. Fire, Carnegie Institute of Washington, Baltimore,MD). In this construct, the heat shock elements of the 16–48 gene are intact but can be removed either by PstI digestion or by double digestion with PstI and HindIII. pJM77 contains the transcription initiation site, the 5'-UTR, the ATG codon, and the first 15 aminoacids of the 16–48 heat shock protein fused to a GFP-lacZ reporter incorporating 15 synthetic introns. Sequence elements to be testedfor enhancer activity are first multimerized, cloned into the EcoRV site of pBluescript, and transferred as a HindIII–PstI fragment into HindIII–PstI-cleaved pJM77, thereby removing the original heatshock elements and preserving insert orientation.	several copies of Feature : "ges-1.WGATAR" were cloned into pJM77.
Expr11336	Feature : "ges-1.3prime"	A single copy of the sequence from7840 to 8160 bp of Ce-ges-1 was cloned in the forward orientation into pJM77. The vector pJM77 used to test the enhancer activity of candidate sequences was constructed as follows: a 446-bp Sau3A fragment from the promoter of the C. elegans heat shock gene 16-48 was isolated from plasmid pPC16.48-1 (Stringham et al., 1992) and inserted in the correct orientation into BamHI-cleaved vector pPD96.04 (kindly provided by A. Fire, Carnegie Institute of Washington, Baltimore,MD). In this construct, the heat shock elements of the 16-48 gene are intact but can be removed either by PstI digestion or by double digestion with PstI and HindIII. pJM77 contains the transcription initiation site, the 5'-UTR, the ATG codon, and the first 15 aminoacids of the 16-48 heat shock protein fused to a GFP-lacZ reporter incorporating 15 synthetic introns. Sequence elements to be testedfor enhancer activity are first multimerized, cloned into the EcoRV site of pBluescript, and transferred as a HindIII-PstI fragment into HindIII-PstI-cleaved pJM77, thereby removing the original heatshock elements and preserving insert orientation.	Could define: [ges-1.3prime::pJM77]. In this case in the construct model you need the WBsf -Feature-ges-1.3prime- and the clone pJM77

Transgene

?Transgene      
Summary UNIQUE ?Text                               
Synonym ?Text                   
Construction //Strain_construction
Construct       ?Construct XREF Transgene_construction
Fragment Text ?Text  //Can this be replaced by Construct?
Coinjection_marker ?Text //remove?, replaced by selection_marker in ?Construct
Integration_method UNIQUE ?Text                                                    
Laboratory ?Laboratory #Lab_Location    
Author ?Author                   
Genetic_information                            
     Extrachromosomal                
Integrated
Map ?Map  #Map_position  
Phenotype ?Phenotype XREF Transgene #Phenotype_info
Phenotype_not_observed ?Phenotype XREF Not_in_Transgene #Phenotype_info  
Used_for                                                     
Expr_pattern ?Expr_pattern XREF Transgene  
Marker_for   ?Text #Evidence 
Gene_regulation ?Gene_regulation XREF Transgene 
Interactor ?Interaction
Topic_marker ?Process XREF Transgene
Associated_with                   
Marked_rearrangement ?Rearrangement XREF By_transgene
Clone ?Clone XREF Transgene Text 
Strain ?Strain XREF Transgene 
Reference ?Paper XREF Transgene  
Species UNIQUE ?Species       
Remark ?Text #Evidence