Talk:WormBase Model:Construct
Contents
Variation
?Variation
Variation_type
Engineered_allele
Variation_summary //to house final engineered construct
Derived_from ?Construct XREF Variation
Corresponding_transgene Unique ?Transgene XREF Identical_variation
Method
Homologous_recombination
NHEJ //Non-homologous DNA end-joining, imprecise DNA repair
MosSci
Cas9
CRISPR
ZFN-NHEJ repair //Zinc-finger nuclease
ZFN-HR repair
Expr_pattern ?Expr_pattern XREF Variation #Evidence
notes on variation model changes
NOTE: the variation model currently has the following tags
- Nature_of_variation UNIQUE
- Polymorphic //would this be complex fusions and chimeras?
- Synthetic //Would this be simple fusions
Do you know what these were intended for? Could they be used to house engineered alleles?
Mary Ann says "I do not know what the Nature_of_variation tag was intended for and, as I think you've noted, it is not populated. It might be that it was intended to be used to describe whether the variation is naturally occurring (polymorphic) or manmade (synthetic). If this is the case, then we have since adopted the use of the sub-tags SNP, Natural_variant or Allele (to the right of Variation_type) to indicate natural vs. manmade and I think it might be redundant to use the Nature_of_variation tag as well. As you've proposed to add the new Variation_type Engineered_allele I think this should be sufficient. We could then remove the Nature_of_variation tag. I would update e.g the Mos1 insertions to have Engineered_allele. They are currently have Variation_type Allele and Transposon_insertion."
<Karen> Ok, I will ignore the Nature_of_variation.
Mary Ann says: NHEJ. Are we expecting a large number of these? This seems like a really specific Method. Likewise ZFN-NHEJ and ZFN-HR. Is the "repair" meant to be part of the Method?
Have changed Crispr to CRISPR
If Variation_summary is proposed to only ever house information about final engineered construct then I think the tag name should be more specific. Otherwise curators may see this as a place to add any other information.
Have changed Identical_transgene to Corresponing_transgene nb have not updated Transgene model.
Construct (new)
?Construct //WBConstructID
Public_name ?Text //variation name (cp7); transgene name (oxIs12, oxEx432)
Other_name ?Text
Summary ?Text //genotype [Pmyo-2::UNC-46::GFP]
Sequence_feature ?Feature XREF Construct //WBsf object, created by Hinxton when needed, with precise ends for mapping to genome
Driven_by ?Gene XREF Drives_construct //this tag is currently Drives_Transgene in the Gene model, it should be changed to Drives_construct
Gene ?Gene
Fusion_reporter ?Text //fluorescent proteins GFP, RFP, mCherry, etc.
Other_reporter ?Text //to add reporters, e.g., reporters not in Fusion_reporter list or genes from other species
Purification_tag ?Text //FLAG, HA, Myc, TAP, etc.
Type_of_construct
Chimera
Domain_swap
Engineered mutation
Fusion
Complex_fusion // complex changes (e.g. GFP fusion plus point mutations)
Transcriptional_fusion
Translational_fusion
N-terminal_translational_fusion
C-terminal_translational_fusion
Internal_coding_fusion
Selection_marker ?Text //for unc-119(+), lin-15(+), drug selection
Construction_summary ?Text //Backbone vector, mol bio
Used_for
Transgene_construction ?Transgene XREF Construct
Variation ?Variation XREF Engineered_allele
Reference ?Paper XREF Construct
Person ?Person XREF Construct
Laboratory ?Laboratory #Lab_Location
Remark ?Text #Evidence
notes on construct model
Chris’ thoughts: We could add a tag to capture the entire DNA sequence of the object (DNA_text or something). Maybe we could also add a Species tag to capture which species’ sequences are incorporated. As per our discussion at group meeting, I think it would ultimately be good to distinguish sequences/features that drive transcription (e.g. promoter sequences, enhancers, etc.) from those that direct post-transcriptional regulation (3’ UTRs) and non-regulatory (backbone) sequences. This way ?Expr_pattern, for example, can pull the relevant sequence/feature info from the ?Construct object.
Xiaodong says
- wouldn't adding DNA text be a redundant work to ?feature curation, which basically positioning sequences on genome?
- aren't promoters/enhaners, and/or 3' UTRs...information already captured in transgene cuation?
--kjy (talk) 00:48, 8 March 2014 (UTC) yes, if you copy in the sequences that are used to define the seq_feature, but I think this field would be used for things that are not seq_feature curated objects.
Daniela: for the backbone vector we could use the ?Clone class. I was looking up some example scenarios e.g. Expr1049_Ex and in the summary they use vector pPD95.67. Only problem is that I checked on the site and pPD95.67 exists but has no sequence info.
Mary Ann says
- Could Fusion_reporter be a controlled vocabulary? This makes searching easier. Likewise Purification_tag?
<karen>: they are a controlled vocabulary during curation. I don't like putting these lists into the model as they are not easy to update, but people disagree with me.
- Type_of_construct has Engineered mutation (I presume this should be Engineered_mutation). Could this be Engineered_allele so that it is consistent with the Variation_type in ?Variation. <karen>: these are two different things. I've fixed "Engineered_mutation" in the model
- I do not understand the format of the Complex tag and the ones underneath (up to and including Internal_coding_fusion). Are these all different tags? <karen>: yes, these are all different tags. They were proposed by Tim.
- Do you want to include the Strain in the Construct model? If so, then it might be good to have an Origin tag with the following sub-tags: Species, Laboratory and Person.
<karen>: no, I don't think the strain should be in this model. The construct model describes the elements that make up the variation or the transgene, which are the objects that the strain should be containing.
- I think it would be good to have Status. <karen>: what is would status signify?
- I like Chris' suggestion of capturing the entire DNA sequence. I was talking to Jonathan Ewbank at the Strasbourg meeting and he also suggested this (though he was thinking more of gbrowse representation). He suggested that if this was too big an overhead for us to do we could link to source databases which already display the DNA sequence. Something to think about.
- The model has no Name tag. Is this intentional? <karen>: no, added it
Overall, I like the model and think it goes a long way to capturing the info. we need. I have no idea whether the model works! Have you tested it? Paul D will certainly want you to have done this prior to proposal - though I think he's seen earlier versions already.
dealing with precise ends
For mapping constructs to the genome - mainly for expression, but should also be used for rescuing constructs
Notes and thoughts for incorporation of precise ends objects into the construct class (Daniela):
We have approx 1000 objects with precise ends 'tags'.
Annotations have sometimes murky boundaries for sequences, especially very old annotations. no primer info. e.g.: Expr1265: All construct contains 3kb of 5'UTR. dys-1::gfp VIII: 3'end in exon 5. Other constructs end at exon 1 or 3. --precise ends.
Expr1275: [clk-1::gfp] translational fusion with clk-1 coding region and upstream gene toc-1 and 624bp 5' of the toc-1 start region. --precise ends
no info on where the construct ends. Presumably stop codon?
Expr1049: [rgs-2::gfp] translational fusion. GFP reporter construct was constructed by inserting genomic DNA fragments from rgs-2 into the vector pPD95.67. The construct contained the promoter regions and 5' coding sequences of the RGS gene, such that a coding exon for the gene was fused in frame to the coding sequence for GFP. The rgs-2 transgene contained sequences from -4770 to +3592 (relative to the rgs-2 translation start), and thus included the large first intron of rgs-2. --precise ends.
They don't specify the promoter region. How can we map precisely to the sequence?
Issue of sequence coordinates varying with gene models. Something published 10 years ago should be remapped. Worth it? To cite Paul D: “..you need to establish what release of the database the data was generated against or have some other form of identifying how to correct the drift, once you can do that we can transform the coordinates forward if they are a large batch else you would have to do it manually.”
incorporating sequence features
For the examples I came across until now it seems that Having in the ?Construct model the Sequence feature ?Feature XREF Construct and a ?Clone tag would suffice -as long as the ?Clone class is maintained DR
examples:
Expr_pattern Feature Reporter gene Notes Expr11274 Feature : "ceh-13.enh450" WBsf919527 enh450 (23256 to 26172) was amplified by PCR using primers RP3Cel.H.do and RP3Cel.H.up for cloning into pMF1DH3 (pRK24) or pPD107.94 (pRK23), and primers RP3D.K.up and RP3D.B.do for cloning into pCb. Could define ceh-13.enh450::pMF1DH3 or ceh-13.enh450::pPD107.94. In this case in the construct model you need the WBsf -Feature-ceh-13.enh450- and the clone pMF1DH3 and pPD107.94 Expr11275 Feature : "ceh-13.enh3.4" WBsf919526 enh3.4 (nucleotide positions 23256 to 26644) was cut from pMF1 for cloning into pPD107.94 (pASF43), or PCR amplified using primers 3.3up and 3.3down for cloning into pCb. Could define ceh-13.enh3.4::pPD107.94. In this case in the construct model you need the WBsf -Feature-13.enh3.4- and the clone PD107.94 Expr11276 Feature : "ceh-13.enh740" WBsf919528 enh740 (nucleotide positions 24001 to 26644) was PCR amplified using primers CCCAAGCTTTCAGATCCCTCCACATGTC and TCTGGTAGACTGTGCAAGCAAC for cloning into pPD107.94 (pRK29) or primers GGGGTACCTCAGATCCCTCCACATGTC and CGGGATCCTGGATCTTAGGGAATTGTGG for cloning into pCb. Could define ceh-13.enh740::pRK29 and ceh-13.enh740::pCb. In this case in the construct model you need the WBsf -Feature-ceh-13.enh740::pRK29- and the clone pRK29 and pCb Expr11277 Feature : "ceh-22.proximal" ceh-22.proximal::(del)Pes-10::lacZ. Could define ceh-22.proximal::(del)Pes-10::lacZ. Expr11278 Feature : "ceh-22.PE1" WBTransgene00019185. [PE1::(del)pes-10::lacZ] In the construct model you need the WBsf -ceh-22.PE1- and the clone pPD95.21 ((del)Pes-10::lacZ). Expr11279 Feature : "ceh-22.pe39_pe41" WBTransgene00018710, WBTransgene00018711. [pe39::(del)pes-10::lacZ], [pe41::(del)pes-10::lacZ] In the construct model you need the WBsf -ceh-22.pe39_pe41- and the clone pPD95.21 ((del)Pes-10::lacZ). Expr11280 Feature : "ceh-22.pe27" WBTransgene00019186 ( WBTransgene00019186 ). [pe27::(del)pes-10::lacZ] In the construct model you need the WBsf -ceh-22.pe27- and the clone pPD95.21 ((del)Pes-10::lacZ). Expr11281 Feature : "ceh-24.vulval" The DNA sequence from Feature"ceh-24.vulval" was assayed upstream of a truncated pes-10 promoter fragment driving lacZ -pPD95.18. Could define ceh-24.vulval::pPD95.18. In this case in the construct model you need the WBsf -ceh-24.vulval- and the clone pPD95.18. Expr11282 Feature : "ceh-24.pm8" The DNA sequences from Feature"ceh-24.pm8" was assayed in front of a truncated myo-2 promoter -pPD95.62. Could define ceh-24.pm8::pPD95.62. In this case in the construct model you need the WBsf -ceh-24.pm8- and the clone pPD95.62. Expr11283 Feature : "egl-17.vulDC" A 64-bp fragment, located between 366 and 303 bp upstream of the egl-17 ATG was inserted into the pPD122.53 vector, which contains the minimal pes-10 promoter. Could define: [Feature-egl-17.vulDC::pPD122.53]. In this case in the construct model you need the WBsf -Feature-egl-17.vulDC- and the clone pPD122.53 Expr11284 Feature : "egl-17.distal" Distal enhancer inserted into the pPD122.53 vector, which contains the minimal pes-10 promoter. Could define: [egl-17.distal::pPD122.53]. In this case in the construct model you need the WBsf -Feature-egl-17.distal- and the clone pPD122.53 Expr11285 Feature : "egl-17.proximal" Proximal enhancer inserted into the pPD122.53 vector, which contains the minimal pes-10 promoter. Could define: [egl-17.proximal::pPD122.53]. In this case in the construct model you need the WBsf -Feature-egl-17.proximal- and the clone pPD122.53 Expr11335 Feature : "ges-1.WGATAR" Six or seven copies of WGATAR sites in either orientation were inserted into the test vector pJM77. The vector pJM77 used to test the enhancer activity of candidate sequences was constructed as follows: a 446-bp Sau3A fragment from the promoter of the C. elegans heat shock gene 16–48 was isolated from plasmid pPC16.48-1 (Stringham et al., 1992) and inserted in the correct orientation into BamHI-cleaved vector pPD96.04 (kindly provided by A. Fire, Carnegie Institute of Washington, Baltimore,MD). In this construct, the heat shock elements of the 16–48 gene are intact but can be removed either by PstI digestion or by double digestion with PstI and HindIII. pJM77 contains the transcription initiation site, the 5'-UTR, the ATG codon, and the first 15 aminoacids of the 16–48 heat shock protein fused to a GFP-lacZ reporter incorporating 15 synthetic introns. Sequence elements to be testedfor enhancer activity are first multimerized, cloned into the EcoRV site of pBluescript, and transferred as a HindIII–PstI fragment into HindIII–PstI-cleaved pJM77, thereby removing the original heatshock elements and preserving insert orientation. several copies of Feature : "ges-1.WGATAR" were cloned into pJM77. Expr11336 Feature : "ges-1.3prime" A single copy of the sequence from7840 to 8160 bp of Ce-ges-1 was cloned in the forward orientation into pJM77. The vector pJM77 used to test the enhancer activity of candidate sequences was constructed as follows: a 446-bp Sau3A fragment from the promoter of the C. elegans heat shock gene 16-48 was isolated from plasmid pPC16.48-1 (Stringham et al., 1992) and inserted in the correct orientation into BamHI-cleaved vector pPD96.04 (kindly provided by A. Fire, Carnegie Institute of Washington, Baltimore,MD). In this construct, the heat shock elements of the 16-48 gene are intact but can be removed either by PstI digestion or by double digestion with PstI and HindIII. pJM77 contains the transcription initiation site, the 5'-UTR, the ATG codon, and the first 15 aminoacids of the 16-48 heat shock protein fused to a GFP-lacZ reporter incorporating 15 synthetic introns. Sequence elements to be testedfor enhancer activity are first multimerized, cloned into the EcoRV site of pBluescript, and transferred as a HindIII-PstI fragment into HindIII-PstI-cleaved pJM77, thereby removing the original heatshock elements and preserving insert orientation. Could define: [ges-1.3prime::pJM77]. In this case in the construct model you need the WBsf -Feature-ges-1.3prime- and the clone pJM77
Expression_pattern
proposed addition
Variation ?Variation XREF Expression_pattern ==Clone== add tag <pre> Construct ?Construct XREF Clone
?Clone Evidence #Evidence Remark General_remark ?Text Y_remark ?Text PCR_remark ?Text Position Map ?Map XREF Clone #Map_position Pmap UNIQUE ?Contig XREF Clone UNIQUE Int UNIQUE Int Clone_left_end ?Sequence Clone_right_end ?Sequence Pos_neg_data ?Pos_neg_data Positive Positive_gene ?Gene XREF Positive_clone Positive_variation ?Variation XREF Positive_clone ?Author Inside_rearr ?Rearrangement XREF Clone_inside ?Author Hybridizes_to ?Clone XREF Positive_probe ?Grid Hybridizes_weak ?Clone XREF Pos_probe_weak ?Grid Positive_probe ?Clone XREF Hybridizes_to ?Grid Pos_probe_weak ?Clone XREF Hybridizes_weak ?Grid Negative Negative_gene ?Gene XREF Negative_clone Negative_locus ?Locus XREF Negative_clone ?Author Outside_rearr ?Rearrangement XREF Clone_outside ?Author Negative_probe ?Clone XREF Does_not_hybridize_to ?Grid Does_not_hybridize_to ?Clone XREF Negative_probe ?Grid In_strain ?Strain XREF Clone Species UNIQUE ?Species Sequence ?Sequence XREF Clone PCR_product ?PCR_product XREF Clone Length Seq_length UNIQUE Int Gel_length UNIQUE Float Location ?Laboratory #Lab_Location URL Text Gridded ?Grid Grid_data ?Grid_data FingerPrint Gel_Number UNIQUE Int Approximate_Match_to UNIQUE ?Clone XREF Canonical_for Exact_Match_to UNIQUE ?Clone XREF Canonical_for Funny_Match_to UNIQUE ?Clone XREF Canonical_for Canonical_for ?Clone UNIQUE Int UNIQUE Int Bands UNIQUE Int UNIQUE Int Gel ?Motif #Lane Contig9 Chromosome UNIQUE ?Map Vaxmap UNIQUE Float In_situ UNIQUE Int UNIQUE Int Cosmid_grid Canon_for_cosmid Flag UNIQUE Int Autopos Expression_construct Pattern ?Text Reference ?Paper XREF Clone cDNA_group Contains ?Clone XREF Contains Text Contained_in ?Clone XREF Contained_in Best_match UNIQUE ?Text Expr_pattern ?Expr_pattern XREF Clone Sequence_status Shotgun UNIQUE DateType Finished UNIQUE DateType Accession_number UNIQUE ?Text DB_info Database ?Database ?Database_field ?Accession_number XREF Clone Type UNIQUE Cosmid Fosmid YAC cDNA Plasmid Other Text Transgene ?Transgene XREF Clone Derived_from ?Clone
Transgene
?Transgene
Summary UNIQUE ?Text
Synonym ?Text
Identical_variation Unique ?Variation XREF Identical_transgene //put in to unambiguously associate the allele/transgene object - NOTE: these objects will have the same public_name, and should be synchronized through the Engineered_allele tag in ?Variation - that is any variation that has tag Engineered_allele will have to have a corresponding transgeneID, so perhaps this XREF Identical_variation tag is not necessary
Construction //Strain_construction
Construct ?Construct XREF Transgene_construction
Fragment Text ?Text //Can this be replaced by Construct?
Coinjection_marker ?Text //remove?, replaced by selection_marker in ?Construct
Integration_method UNIQUE ?Text
Laboratory ?Laboratory #Lab_Location
Author ?Author
Genetic_information
Extrachromosomal
Integrated
Map ?Map #Map_position
Phenotype ?Phenotype XREF Transgene #Phenotype_info
Phenotype_not_observed ?Phenotype XREF Not_in_Transgene #Phenotype_info
Used_for
Expr_pattern ?Expr_pattern XREF Transgene
Marker_for ?Text #Evidence
Gene_regulation ?Gene_regulation XREF Transgene
Interactor ?Interaction
Topic_marker ?Process XREF Transgene
Associated_with
Marked_rearrangement ?Rearrangement XREF By_transgene
Clone ?Clone XREF Transgene Text
Strain ?Strain XREF Transgene
Reference ?Paper XREF Transgene
Species UNIQUE ?Species
Remark ?Text #Evidence
sample transgene data
Transgene : "WBTransgene00000083" Public_name "axIs1140" Summary "[pie-1::gfp-mbk-2]" Construction_summary "Clone = pJP1.02. A genomic fragment spanning the ORF in mbk-2c was cloned into two vectors, pJH4.52 and pID3.01, to create amino-terminal GFP fusions. These vectors utilize pie-1 5' and 3' UTR sequences to drive expression of the transgene in the maternal germline. GFP lines were created by the complex array method or by the microparticle bombardment method (pID3.01). Several independent lines were established using each technique. Although expression levels varied from line to line, all lines showed the same overall distribution of GFP:MBK-2." Reporter_product "GFP" Driven_by_gene "WBGene00004027" Gene "WBGene00003150" Integration_method "Particle_bombardment" Integrated Strain "JH1576" Reference "WBPaper00006085" Reference "WBPaper00026970" Reference "WBPaper00027048" Reference "WBPaper00028588" Reference "WBPaper00031014" Reference "WBPaper00031015" Reference "WBPaper00035426"
