Difference between revisions of "WormBase Model:Construct"

From WormBaseWiki
Jump to navigationJump to search
 
(101 intermediate revisions by 4 users not shown)
Line 2: Line 2:
  
 
__TOC__
 
__TOC__
 +
=Model changes=
 +
===WS251===
 +
<pre>
 +
Construct_for_disease ?DO_term XREF Associated_construct #Evidence
 +
</pre>
 +
 
=Proposed model changes=
 
=Proposed model changes=
 
Purpose: the technology of engineering mutations and gene replacement has been developed in C. elegans.  With these new research tools, capture and display of the molecular information of these alleles needs to be updated. We propose a new class, Construct, to capture the specifics of the DNA tool used to perform the replacement or engineering, while the Variation model gets updated to record the engineering event itself and its impact on the genome. As a side benefit to the creation of the Construct model, we can use this new class to also capture the genomic arrays used create transgenes.  
 
Purpose: the technology of engineering mutations and gene replacement has been developed in C. elegans.  With these new research tools, capture and display of the molecular information of these alleles needs to be updated. We propose a new class, Construct, to capture the specifics of the DNA tool used to perform the replacement or engineering, while the Variation model gets updated to record the engineering event itself and its impact on the genome. As a side benefit to the creation of the Construct model, we can use this new class to also capture the genomic arrays used create transgenes.  
−
 
  
 
==Variation==
 
==Variation==
 +
Proposed additions
 
<pre>
 
<pre>
 
?Variation
 
?Variation
 
Variation_type  
 
Variation_type  
−
Engineered_allele  
+
    Engineered_allele  
−
Variation_summary //to house final engineered construct
+
Variation_summary ?Text//to house final engineered construct
−
    Derived_from ?Construct XREF Variation
+
Derived_from ?Construct XREF Engineered_variation
 +
Corresponing_transgene Unique ?Transgene XREF Corresponding_variation
 
Method  
 
Method  
−
     Homologous_recombination  
+
     Homologous_recombination //Homologous_recombination
−
     NHEJ
+
     NHEJ //Non-homologous DNA end-joining, imprecise DNA repair
 
     MosSci
 
     MosSci
−
     Cas9
+
     TALENs
−
     Crispr
+
     CRISPR_Cas9
 +
    ZFN-NHEJ repair //Zinc-finger nuclease
 +
    ZFN-HR repair
 
Expr_pattern ?Expr_pattern XREF Variation #Evidence
 
Expr_pattern ?Expr_pattern XREF Variation #Evidence
 +
 
</pre>
 
</pre>
 
===notes on variation model changes===
 
===notes on variation model changes===
−
NOTE: the variation model currently has the following tags
+
''see discussion tab''
−
*Nature_of_variation UNIQUE
+
 
−
**Polymorphic //would this be complex fusions and chimeras?
+
WBPaper00045772 [http://tazendra.caltech.edu/~acedb/daniel/00045772_Paix14_temp.pdf Paix et al., 2014]<br>
−
**Synthetic //Would this be simple fusions
+
Discusses Homology directed repair (HDR) vs Nonhomologous end-joining (NHEJ).  It would seem that distinguishing the method used to create engineered alleles is important. However, the tags should perhaps be modified to distinguish double stranded break method and repair method.
  
−
Do you know what these were intended for? Could they be used to house engineered alleles?�
+
<pre>
 +
break_made_by
 +
  Mos_excision
 +
  CRISPR/Cas9
 +
  TALENs
 +
  Zinc_finger_endonuclease
 +
  OTHER
  
−
Mary Ann says "I do not know what the Nature_of_variation tag was intended for and, as I think you've noted, it is not populated. It might be that it was intended to be used to describe whether the
+
repaired_by
−
variation is naturally occurring (polymorphic) or manmade (synthetic).  If this is the case, then we have since adopted the use of the sub-tags SNP, Natural_variant or Allele  (to the right of Variation_type) to indicate natural vs. manmade and I think it might be redundant to use the Nature_of_variation tag as well. As you've proposed to add the new Variation_type Engineered_allele I think this should be sufficient. We could then remove the Nature_of_variation tag. I would update e.g the Mos1 insertions to have Engineered_allele. They are currently have Variation_type Allele and Transposon_insertion."
+
  nonhomologous_end_joining_NHEJ
 +
  homologous_direct_repair_HDR
 +
 
 +
repair_template
 +
  Construct (note, ssODNs (single-strand oligonucleotides) should be added as a construct_type)
 +
 
 +
 
 +
</pre>
 +
 
 +
 
 +
 
 +
--[[User:Kyook|Kyook]] ([[User talk:Kyook|talk]]) 21:17, 16 October 2014 (UTC)
  
 
==Construct (new)==
 
==Construct (new)==
 +
Class itself is new
 +
<pre>
 +
?Construct Evidence #Evidence
 +
  Curator_confirmed ?Person
 +
  Public_name ?Text
 +
  Other_name ?Text
 +
  Summary ?Text                      //genotype like [Pmyo-2::GFP]
 +
  Sequence_feature ?Feature XREF Associated_with_construct
 +
  Driven_by_gene ?Gene XREF Drives_construct #Evidence
 +
  Gene ?Gene XREF Construct_product #Evidence
 +
  3_UTR ?Gene #Evidence
 +
  Fusion_reporter ?Text              //fluorescent proteins GFP, RFP, mCherry, etc.
 +
  Other_reporter ?Text              //to add reporters, tags that aren�-F¢t included in model�-A
 +
  Purification_tag ?Text            //FLAG, HA, Myc, TAP, etc.
 +
  Recombination_site ?Text          //LoxP, FRT
 +
  Type_of_construct  Chimera
 +
      Domain_swap
 +
      Engineered_mutation
 +
      Fusion
 +
      Complex                    // complex changes
 +
      Transcriptional_fusion
 +
      Translational_fusion
 +
      Nterminal_translational_fusion
 +
      Cterminal_translational_fusion
 +
      Internal_coding_fusion
 +
  Selection_marker ?Text
 +
  Construction_summary  ?Text        // Backbone vector, mol bio
 +
  DNA_text Text                      // for mapping, can include entire construct sequence
 +
  Clone ?Clone XREF Construct
 +
  Used_for Transgene_construct ?Transgene XREF Construct
 +
    Transgene_coinjection ?Transgene XREF Coinjection
 +
    Engineered_variation ?Variation XREF Derived_from_construct
 +
    Topic_output_indicator ?WBProcess XREF Marker_construct
 +
    Expression_pattern ?Expr_pattern XREF Construct
 +
    Interactor ?Interaction
 +
  Reference ?Paper
 +
  Person ?Person
 +
  Laboratory ?Laboratory #Lab_Location
 +
  Historical_gene ?Gene #Evidence
 +
  Remark ?Text #Evidence
 +
 +
</pre>
 +
 +
===notes on construct model===
 +
''see discussion tab''
 +
 +
==#Interactor_info==
 +
  Construct ?Construct XREF Interactor
 +
 +
==Interaction==
 +
  Unaffiliated_construct  ?Construct
 +
  Detection_method    Construct
 +
 +
==Expression_pattern==
 +
proposed addition
 +
<pre>
 +
Variation ?Variation XREF Expression_pattern
 +
Construct ?Construct XREF Expression_pattern
 +
</pre>
 +
 +
==Gene==
 +
proposed change
 +
<pre>
 +
Drives_Transgene ?Transgene XREF Driven_by_gene
 +
change to
 +
Drives_construct ?Construct XREF Driven_by_gene
 +
</pre>
 +
 +
==Transgene==
 +
Proposed changes: Many of the transgene tags have been moved to the proposed ?Construct model, the remaining tags as well as some additions are shown below
 +
<pre>
 +
?Transgene      Evidence #Evidence
 +
Public_name UNIQUE ?Text
 +
Summary UNIQUE ?Text
 +
Synonym ?Text
 +
Corresponding_variation UNIQUE ?Variation XREF Corresponding_transgene //put in to unambiguously associate the allele/transgene
 +
Construction Construct  ?Construct XREF Transgene_construct
 +
        Coinjection ?Construct XREF Transgene_coinjection
 +
        Coinjection_other ?Text //for coinjection markers that are not specified as a construct
 +
        Integration_method UNIQUE ?Text
 +
        Integrated_from ?Transgene XREF Transgene_derivation
 +
        Laboratory ?Laboratory #Lab_Location
 +
        Author ?Author
 +
Construction_summary ?Text
 +
Genetic_information Extrachromosomal
 +
    Integrated
 +
    Map ?Map  #Map_position  //needed for transgenes with no granular mapping, e.g., just mapped to a LG
 +
                                    Mapping_data 2_point ?2_point_data      //deleted for WS245, rolled back for WS246
 +
    Map_evidence #Evidence
 +
    Phenotype ?Phenotype XREF Transgene #Phenotype_info
 +
    Phenotype_not_observed ?Phenotype XREF Not_in_Transgene #Phenotype_info
 +
Used_for Transgene_derivation ?Transgene XREF Integrated_from
 +
Expr_pattern ?Expr_pattern XREF Transgene
 +
Marker_for  ?Text #Evidence
 +
Interactor ?Interaction
 +
Associated_with Marked_rearrangement ?Rearrangement XREF By_transgene
 +
Strain ?Strain XREF Transgene
 +
Reference ?Paper XREF Transgene
 +
Species UNIQUE ?Species
 +
Remark ?Text #Evidence
 +
                Historical_gene  ?Gene #Evidence
 +
 +
</pre>
 +
 +
==WBProcess==
 +
    Marker_construct ?Construct XREF Topic_output_indicator
 +
 +
=Test data=
 +
===Variation objects with constructs===
 +
LP132 nmy-2(cp7[nmy-2::gfp + LoxP unc-119(+) LoxP]) I; unc-119(ed3) I
 
<pre>
 
<pre>
−
?Construct
+
Variation : "WBVar020000000"
−
Summary  ?Text
+
Public_name "cp7"
−
Sequence feature ?Feature XREF Construct
+
Engineered_allele
−
Gene ?Gene
+
Variation_summary "[nmy-2::gfp + LoxP unc-119(+) LoxP]"
−
Gene_site_targeted ?SO_term   
+
Derived_from "WBConstruct00000010"
−
Fusion_reporter ?Text //fluorescent proteins GFP, RFP, mCherry, etc.
+
Derived_from "WBConstruct00000011"
−
Other_reporter ?Text //to add reporters, tags that aren’t included in model
+
Homologous_recombination
−
Purification_tag ?Text //FLAG, HA, Myc, TAP, etc. 
+
 
−
Type_of_construct
+
Construct : "WBConstruct00000010"
−
    Chimera
+
Summary "[nmy-2::gfp]
−
    Domain_swap
+
Driven_by_gene "WBGene00003777"
−
    Engineered mutation
+
Fusion_reporter "GFP"
−
    Fusion
 
−
Complex // complex changes (e.g. GFP fusion plus point mutations) 
 
−
        Transcriptional_fusion
 
−
Translational_fusion
 
 
N-terminal_translational_fusion
 
N-terminal_translational_fusion
 +
 +
Construct : "WBConstruct00000011"
 +
Summary "[LoxP unc-119(+) LoxP]
 +
Recombination_site "LoxP"
 +
Gene "WBGene00003777"
 +
</pre>
 +
-------------------------------
 +
bus-50(e5000[T110E]) = An engineered missense mutation
 +
-------------------------------
 +
bus-50(e5001[bus-50::gfp]) aka bus-50::gfp =
 +
  An engineered fusion of GFP to the C-terminus of BUS-50
 +
 +
<pre>
 +
Variation : "WBVar0200000001"
 +
Public_name "e5001"
 +
Engineered_allele
 +
Variation_summary "[bus-50::gfp]"
 +
Derived_from "WBConstruct00000012"
 +
CRISPR-Cas9
 +
 +
Construct : "WBConstruct00000012"
 +
Summary "[bus-50::gfp]"
 +
Gene "WBGene0020000001"
 +
Fusion_reporter "GFP"
 
C-terminal_translational_fusion
 
C-terminal_translational_fusion
−
Internal_coding_fusion
+
 
−
Selection_marker    ?Text    //for unc-119(+), lin-15(+), drug selection
 
−
Construction_summary  ?Text    //Backbone vector, mol bio
 
−
Used_for
 
−
    Transgene_construction ?Transgene XREF Construct
 
−
    Variation ?Variation XREF Engineered_allele   
 
−
Reference ?Paper XREF Construct 
 
−
Person ?Person XREF Construct
 
−
Laboratory ?Laboratory #Lab_Location
 
−
Remark ?Text #Evidence
 
 
</pre>
 
</pre>
 +
-------------------------------
 +
bus-50(e5002[bus-50::gfp + loxP unc-119(+) loxP])
 +
  An engineered insertion of GFP plus the unc-119(+) selectable marker, flanked by loxP sites.
  
−
===notes on construct model===
+
<pre>
−
Chris’ thoughts: We could add a tag to capture the entire DNA sequence of the object (DNA_text or something). Maybe we could also add a Species tag to capture which species’ sequences are incorporated. As per our discussion at group meeting, I think it would ultimately be good to distinguish sequences/features that drive transcription (e.g. promoter sequences, enhancers, etc.) from those that direct post-transcriptional regulation (3’ UTRs) and non-regulatory (backbone) sequences. This way ?Expr_pattern, for example, can pull the relevant sequence/feature info from the ?Construct object.
+
Variation : "WBVar020000003"
 +
Public_name "e5002"
 +
Engineered_allele
 +
Variation_summary "[bus-50::gfp + loxP unc-119(+) loxP]"
 +
Derived_from "WBConstruct00000012"
 +
Derived_from "WBConstruct00000011"
 +
HR
 +
 
 +
Construct : "WBConstruct00000012"
 +
Summary "[bus-50::gfp]"
 +
Gene "WBGene0020000001"
 +
Fusion_reporter "GFP"
 +
C-terminal_translational_fusion
 +
 
 +
 
 +
Construct : "WBConstruct00000011"
 +
Summary "[LoxP unc-119(+) LoxP]
 +
Recombination_site "LoxP"
 +
Gene "WBGene00003777"
  
−
Daniela: for the backbone vector we could use the ?Clone class. I was looking up some example scenarios e.g. Expr1049_Ex and in the summary they use vector pPD95.67. Only problem is that I checked on the site and pPD95.67 exists but has no sequence info.
+
</pre>
 +
-------------------------------
 +
bus-50(e5003[bus-50::gfp +loxP]) aka bus-50(e5003) =
 +
  bus-50(e5002) following Cre-mediated recombinase removal of unc-119(+) leaving a single loxP site
 +
<pre>
 +
Variation : "WBVar020000004"
 +
Public_name "e5003"
 +
Engineered_allele
 +
Variation_summary "[bus-50::gfp + loxP]"
 +
Derived_from "WBConstruct00000012"
 +
Derived_from "WBConstruct00000011"
 +
HR
  
 +
Construct : "WBConstruct00000012"
 +
Summary "[bus-50::gfp]"
 +
Gene "WBGene0020000001"
 +
Fusion_reporter "GFP"
 +
C-terminal_translational_fusion
  
−
====dealing with precise ends====
+
Construct : "WBConstruct00000011"
−
For mapping constructs to the genome - mainly for expression, but should also be used for rescuing constructs
+
Summary "[LoxP unc-119(+) LoxP]
 +
Recombination_site "LoxP"
 +
Gene "WBGene00003777"
  
−
Notes and thoughts for incorporation of precise ends objects into the construct class (Daniela):
+
</pre>
  
−
We have approx 1000 objects with precise ends 'tags'.
+
===Variation object with transgene===
 +
eIs2002 = eIs2002[unc-119::gfp] = eIs2002[unc-119::gfp, III:2992500] 
 +
  Engineered insertions in apparent intergenic region with optional
 +
  descriptors (nature of the insertion or position in the genome)
 +
<pre>
 +
Variation : "WBVar020000005"
 +
Public_name "eIs2002"
 +
Engineered_allele
 +
Variation_summary "[unc-119::gfp]"
 +
Derived_from "WBConstruct00000013"
 +
Identical_transgene "WBTransgene00024514"
 +
MosSci
  
−
Annotations have sometimes murky boundaries for sequences, especially very old annotations. no primer info. e.g.:
+
Construct : "WBConstruct00000013"
−
Expr1265: All construct contains 3kb of 5'UTR. dys-1::gfp VIII: 3'end in exon 5. Other constructs end at exon 1 or 3. --precise ends.
+
Summary "[unc-119::gfp]"
 +
Gene "WBGene0020000001"
 +
Fusion_reporter "GFP"
 +
Translational_fusion
  
 +
Transgene : "WBTransgene00024514"
 +
Public_name "eIs2002"
 +
Summary "[unc-119::GFP]"
 +
Construct "WBConstruct00000013"
  
−
Expr1275: [clk-1::gfp] translational fusion with clk-1 coding region and upstream gene toc-1 and 624bp 5' of the toc-1 start region. --precise ends
+
</pre>
−
no info on where the construct ends. Presumably stop codon?
+
-------------------------------
 +
ozIs909, or ozIs909[unc-119::mCherry *eIs2002] =
 +
  Engineered changes to existing Is (or Si) insertions, which should
 +
  receive new Is numbers using originating lab’s prefix. The original
 +
  Is insertion is indicated in brackets with a preceding asterisk (*),
 +
  in order to allow searches for all derivatives from a given insertion.  
 +
  In this case, an engineered change from GFP to mCherry in eIs2002
  
 +
<pre>
 +
Variation : "WBVar020000006"
 +
Public_name "ozIs909"
 +
Engineered_allele
 +
Variation_summary "[unc-119::mCherry *eIs2002]"
 +
Derived_from "WBConstruct00000015"
 +
Identical_transgene "WBTransgene00024515"
 +
MosSci
  
−
Expr1049: [rgs-2::gfp] translational fusion. GFP reporter construct was constructed by inserting genomic DNA fragments from rgs-2 into the vector pPD95.67. The construct contained the promoter regions and 5' coding sequences of the RGS gene, such that a coding exon for the gene was fused in frame to the coding sequence for GFP. The rgs-2 transgene contained sequences from -4770 to +3592 (relative to the rgs-2 translation start), and thus included the large first intron of rgs-2.  --precise ends.
+
Construct : "WBConstruct00000015"
 +
Summary "[unc-119::mCherry]"
 +
Gene "WBGene0020000001"
 +
Fusion_reporter "mCherry"
 +
Translational_fusion
  
−
They don't specify the promoter region. How can we map precisely to the sequence?
+
Transgene : "WBTransgene00024515"
 +
Public_name "ozIs909"
 +
Summary "[unc-119::mCherry]
 +
Construct "WBConstruct00000015"
 +
</pre>
  
−
Issue of sequence coordinates varying with gene models. Something published 10 years ago should be remapped. Worth it? To cite Paul D:
+
===Transgene with construct===
−
“..you need to establish what release of the database the data was generated against or have some other form of identifying how to correct the drift, once you can do that we can transform the coordinates forward if they are a large batch else you would have to do it manually.”
+
The following depicts how current transgenes would be redistributed
 +
into the proposed Construct and Transgene models
  
−
====incorporating sequence features====
 
−
examples:
 
 
<pre>
 
<pre>
−
Expr_pattern Feature Reporter gene Notes
+
(Original)Transgene : "WBTransgene00000001"
−
Expr11274 Feature : "ceh-13.enh450" WBsf919527 enh450 (23256 to 26172) was amplified by PCR using primers RP3Cel.H.do and RP3Cel.H.up for cloning into pMF1DH3 (pRK24) or pPD107.94 (pRK23), and primers RP3D.K.up and RP3D.B.do for cloning into pCb. Could define ceh-13.enh450::pMF1DH3 or ceh-13.enh450::pPD107.94.  In this case in the construct model you need the WBsf -Feature-ceh-13.enh450- and the clone pMF1DH3 and pPD107.94
+
Public_name "adEx1256"
−
Expr11275 Feature : "ceh-13.enh3.4" WBsf919526 enh3.4 (nucleotide positions 23256 to 26644) was cut from pMF1 for cloning into pPD107.94 (pASF43), or PCR amplified using primers 3.3up and 3.3down for cloning into pCb. Could define ceh-13.enh3.4::pPD107.94. In this case in the construct model you need the WBsf -Feature-13.enh3.4- and the clone PD107.94
+
Summary "[egl-19::sGFP-NLS + lin-15(+)]"
−
Expr11276 Feature : "ceh-13.enh740" WBsf919528 enh740 (nucleotide positions 24001 to 26644) was PCR amplified using primers CCCAAGCTTTCAGATCCCTCCACATGTC and TCTGGTAGACTGTGCAAGCAAC for cloning into pPD107.94 (pRK29) or primers GGGGTACCTCAGATCCCTCCACATGTC and CGGGATCCTGGATCTTAGGGAATTGTGG for cloning into pCb. Could define ceh-13.enh740::pRK29 and ceh-13.enh740::pCb.  In this case in the construct model you need the WBsf -Feature-ceh-13.enh740::pRK29- and the clone pRK29 and pCb
+
Reporter_product "GFP"
−
Expr11277 Feature : "ceh-22.proximal" ceh-22.proximal::(del)Pes-10::lacZ. Could define ceh-22.proximal::(del)Pes-10::lacZ.
+
Driven_by_gene "WBGene00001187"
−
Expr11278 Feature : "ceh-22.PE1" WBTransgene00019185. [PE1::(del)pes-10::lacZ] In the construct model you need the WBsf -ceh-22.PE1- and the clone pPD95.21 ((del)Pes-10::lacZ).
+
Strain "DA1256"
−
Expr11279 Feature : "ceh-22.pe39_pe41" WBTransgene00018710, WBTransgene00018711. [pe39::(del)pes-10::lacZ], [pe41::(del)pes-10::lacZ] In the construct model you need the WBsf -ceh-22.pe39_pe41- and the clone pPD95.21 ((del)Pes-10::lacZ).
+
Reference "WBPaper00029359"
−
Expr11280 Feature : "ceh-22.pe27" WBTransgene00019186 ( WBTransgene00019186 ). [pe27::(del)pes-10::lacZ] In the construct model you need the WBsf -ceh-22.pe27- and the clone pPD95.21 ((del)Pes-10::lacZ).
+
Reporter_type "Transcriptional fusion"
−
Expr11281 Feature : "ceh-24.vulval" The DNA sequence from Feature"ceh-24.vulval" was assayed upstream of a truncated pes-10 promoter fragment driving lacZ -pPD95.18. Could define ceh-24.vulval::pPD95.18. In this case in the construct model you need the WBsf -ceh-24.vulval- and the clone pPD95.18.
+
Synonym "[C48A7.1::gfp]"
−
Expr11282 Feature : "ceh-24.pm8" The DNA sequences from Feature"ceh-24.pm8" was assayed in front of a truncated myo-2 promoter -pPD95.62. Could define ceh-24.pm8::pPD95.62. In this case in the construct model you need the WBsf -ceh-24.pm8- and the clone pPD95.62.
+
 
−
Expr11283 Feature : "egl-17.vulDC" A 64-bp fragment, located between 366 and 303 bp upstream of the egl-17 ATG was inserted into the pPD122.53 vector, which contains the minimal pes-10 promoter. Could define: [Feature-egl-17.vulDC::pPD122.53]. In this case in the construct model you need the WBsf -Feature-egl-17.vulDC- and the clone pPD122.53
+
 
−
Expr11284 Feature : "egl-17.distal" Distal enhancer inserted into the pPD122.53 vector, which contains the minimal pes-10 promoter. Could define: [egl-17.distal::pPD122.53]. In this case in the construct model you need the WBsf -Feature-egl-17.distal- and the clone pPD122.53
+
(New)Transgene : "WBTransgene00000001"
−
Expr11285 Feature : "egl-17.proximal" Proximal enhancer inserted into the pPD122.53 vector, which contains the minimal pes-10 promoter. Could define: [egl-17.proximal::pPD122.53]. In this case in the construct model you need the WBsf -Feature-egl-17.proximal- and the clone pPD122.53
+
Public_name "adEx1256"
−
Expr11335 Feature : "ges-1.WGATAR" Six or seven copies of WGATAR sites in either orientation were inserted into the test vector pJM77. The vector pJM77 used to test the enhancer activity of candidate sequences was constructed as follows: a 446-bp Sau3A fragment from the promoter of the C. elegans heat shock gene 16–48 was isolated from plasmid pPC16.48-1 (Stringham et al., 1992) and inserted in the correct orientation into BamHI-cleaved vector pPD96.04 (kindly provided by A. Fire, Carnegie Institute of Washington, Baltimore,MD). In this construct, the heat shock elements of the 16–48 gene are intact but can be removed either by PstI digestion or by double digestion with PstI and HindIII. pJM77 contains the transcription initiation site, the 5'-UTR, the ATG codon, and the first 15 aminoacids of the 16–48 heat shock protein fused to a GFP-lacZ reporter incorporating 15 synthetic introns. Sequence elements to be testedfor enhancer activity are first multimerized, cloned into the EcoRV site of pBluescript, and transferred as a HindIII–PstI fragment into HindIII–PstI-cleaved pJM77, thereby removing the original heatshock elements and preserving insert orientation. several copies of Feature : "ges-1.WGATAR" were cloned into pJM77.
+
Summary "[egl-19::sGFP-NLS + lin-15(+)]"
−
Expr11336 Feature : "ges-1.3prime" A single copy of the sequence from7840 to 8160 bp of Ce-ges-1 was cloned in the forward orientation into pJM77. The vector pJM77 used to test the enhancer activity of candidate sequences was constructed as follows: a 446-bp Sau3A fragment from the promoter of the C. elegans heat shock gene 16-48 was isolated from plasmid pPC16.48-1 (Stringham et al., 1992) and inserted in the correct orientation into BamHI-cleaved vector pPD96.04 (kindly provided by A. Fire, Carnegie Institute of Washington, Baltimore,MD). In this construct, the heat shock elements of the 16-48 gene are intact but can be removed either by PstI digestion or by double digestion with PstI and HindIII. pJM77 contains the transcription initiation site, the 5'-UTR, the ATG codon, and the first 15 aminoacids of the 16-48 heat shock protein fused to a GFP-lacZ reporter incorporating 15 synthetic introns. Sequence elements to be testedfor enhancer activity are first multimerized, cloned into the EcoRV site of pBluescript, and transferred as a HindIII-PstI fragment into HindIII-PstI-cleaved pJM77, thereby removing the original heatshock elements and preserving insert orientation. Could define: [ges-1.3prime::pJM77]. In this case in the construct model you need the WBsf -Feature-ges-1.3prime- and the clone pJM77
+
Construct "WBConstruct00000001"
 +
Coinjection_other "lin-15(+)"
 +
Extrachromosomal
 +
Strain "DA1256"
 +
Reference "WBPaper00029359"
 +
 
 +
(New)Construct : WBConstruct00000001
 +
Public_name "adEx1256"
 +
Other_name "[C48A7.1::gfp]"
 +
Summary "[egl-19::sGFP-NLS]"
 +
Fusion_reporter "GFP"
 +
Driven_by_gene "WBGene00001187"
 +
Reference "WBPaper00029359"
 +
Transcriptional_fusion
 +
 
 
</pre>
 
</pre>
 +
----------------------------------------------
  
−
==Transgene==
 
 
<pre>
 
<pre>
 +
(Original)Transgene : "WBTransgene00000011"
 +
Public_name "adIs1240"
 +
Summary "[lin-15(+) eat-4::sGFP]"
 +
Reporter_product "GFP"
 +
Driven_by_gene "WBGene00001135"
 +
Strain "DA1240"
 +
Strain "DA1243"
 +
Map "X"
 +
Map_evidence Paper_evidence "WBPaper00038205"
 +
Reference "WBPaper00030960"
 +
Reference "WBPaper00032252"
 +
Reference "WBPaper00035265"
 +
Reference "WBPaper00036277"
 +
Reference "WBPaper00036704"
 +
Reference "WBPaper00037626"
 +
Reference "WBPaper00038205"
 +
Reference "WBPaper00044482"
 +
Synonym "[eat-4::gfp]"
 +
 +
(New)Transgene : "WBTransgene00000011"
 +
Public_name "adIs1240"
 +
Summary "[lin-15(+) eat-4::sGFP]"
 +
Strain "DA1240"
 +
Strain "DA1243"
 +
Map "X"
 +
Map_evidence Paper_evidence "WBPaper00038205"
 +
Coninjection_other "lin-15(+)"
 +
Reference "WBPaper00030960"
 +
Reference "WBPaper00032252"
 +
Reference "WBPaper00035265"
 +
Reference "WBPaper00036277"
 +
Reference "WBPaper00036704"
 +
Reference "WBPaper00037626"
 +
Reference "WBPaper00038205"
 +
Reference "WBPaper00044482"
 +
 +
(New)Construct : "WBConstruct00000011"
 +
Public_name "adIs1240"
 +
Other_name "[eat-4::gfp]"
 +
Summary "[eat-4::sGFP]"
 +
Fusion_reporter "GFP"
 +
Driven_by_gene "WBGene00001135"
 +
Reference "WBPaper00030960"
 +
 +
</pre>
 +
------------------------------------------------
 +
<pre>
 +
(Original) Transgene : "WBTransgene00000017"
 +
Public_name "ajIs1"
 +
Summary "[pgp-5::gfp]"
 +
Coinjection_marker "pRF4[rol-6(su1006)]"
 +
Construction_summary "Integrated from BC10030 sEx864."
 +
Reporter_product "GFP"
 +
Driven_by_gene "WBGene00003999"
 +
Driven_by_gene "WBGene00006767"
 +
Integration_method "Gamma_ray"
 +
Integrated
 +
Reference "WBPaper00002968"
 +
Reference "WBPaper00031023"
  
−
?Transgene    
+
(New) Transgene : "WBTransgene00000017"
−
Summary UNIQUE ?Text                             
+
Public_name "ajIs1"
−
Synonym ?Text                 
+
Integration_method "Gamma_ray"
−
Construction //Strain_construction
 
−
Construct      ?Construct XREF Transgene_construction
 
−
Fragment Text ?Text  //Can this be replaced by Construct?
 
−
Coinjection_marker ?Text //remove?, replaced by selection_marker in ?Construct
 
−
Integration_method UNIQUE ?Text                                                   
 
−
Laboratory ?Laboratory #Lab_Location   
 
−
Author ?Author                 
 
−
Genetic_information                           
 
−
    Extrachromosomal               
 
 
Integrated
 
Integrated
−
Map ?Map #Map_position  
+
Reference "WBPaper00002968"
−
Phenotype ?Phenotype XREF Transgene #Phenotype_info
+
Reference "WBPaper00031023"
−
Phenotype_not_observed ?Phenotype XREF Not_in_Transgene #Phenotype_info  
+
Integrated_from "WBTransgene00002030"
−
Used_for                                                   
+
Construction_summary "Integrated from BC10030 sEx864."
−
Expr_pattern ?Expr_pattern XREF Transgene  
+
 
−
Marker_for  ?Text #Evidence
+
(New) Transgene : "WBTransgene00002030"
−
Gene_regulation ?Gene_regulation XREF Transgene
+
Public_name "sEx864"
−
Interactor ?Interaction
+
Synonym "[pgp-5::gfp]"
−
Topic_marker ?Process XREF Transgene
+
Synonym "[C05A9.1::gfp]"
−
Associated_with                 
+
Summary "[rCesC05A9.1::GFP + pCeh361]"
−
Marked_rearrangement ?Rearrangement XREF By_transgene
+
Extrachromosomal
−
Clone ?Clone XREF Transgene Text
+
Construct "WBConstruct00000017"
−
Strain ?Strain XREF Transgene
+
Construct "WBConstruct00000018"
−
Reference ?Paper XREF Transgene  
+
Construct "WBConstruct00000002"
−
Species UNIQUE ?Species        
+
 
−
Remark ?Text #Evidence
+
(New) Construct : "WBConstruct00000018"
 +
Public_name "pRF4"
 +
Summary "[rol-6(su1006)]"
 +
Gene "WBGene00004397"
 +
 
 +
(New) Construct : "WBConstruct00000017"
 +
Public_name "[pgp-5::gfp]"
 +
Summary "[rCesC05A9.1::GFP]"
 +
Reporter_product "GFP"
 +
Transcriptional_fusion
 +
Driven_by_gene "WBGene00003999"
 +
 
 +
(New) Construct : "WBConstruct00000002"
 +
Public_name "pCeh361"
 +
Summary "[pCeh::DPY-5]"
 +
Clone "pGEM-5
 +
Construction_summary "A 3.3-kb Nco I fragment containing a predicted cuticle
 +
  collagen gene was isolated from the cosmid F27C1, and cloned into the Nco I
 +
  site of pGEM-5 to generate the clone pCeh361"
 +
Reference "WBPaper00027361"
 +
</pre>
 +
---------------------------------------------------
 +
<pre>
 +
(New) Transgene : "WBTransgene00000600"
 +
Public_name "hIs2"
 +
Summary "[DPY-5::GFP + rol-6(su1006) + pBluescript]
 +
Construct  "WBConstruct00000003"//pCeh358
 +
Coinjection "WBConstruct00000004"//PCes1943
 +
Coinjection "WBConstruct00000005"//pBluescript KS
 +
Construction_summary "Transgenic animals were generated by microinjection of
 +
  pCeh358 (5 ng/ul) and pBluescript KS (100 ng/ul), or in combination with 50 ng/ul
 +
  pCes1943, which carries a dominant rol-6 mutation [rol-6(su1006)] used as a
 +
  morphological marker for successful transformation"
 +
 
 +
(New) Construct : "WBConstruct00000003"
 +
Public_name "pCeh358"
 +
Summary "[dpy-5::gfp]"
 +
Driven_by_gene "WBGene00001067"
 +
Gene "WBGene00001067"
 +
Clone "pPD95.69"
 +
Translational_fusion
 +
Construction_summary "The dpy-5::gfp reporter construct pCeh358 was
 +
  generated by insertion of a 750 bp Sph I fragment from pCeh361 into the
 +
  Sph I site of the gfp expression vector pPD95.69 (kindly provided by A. Fire).
 +
  This fragment contains 5' sequences from an Sph I site in the polylinker of
 +
  pCeh361 to a site 30 bp downstream from the predicted DPY-5 initiator methionine,
 +
  resulting in an in-frame fusion of the first 12 codons of dpy-5 with gfp."
 +
Reference "WBPaper00027361"
 +
 
 +
(New) Construct : "WBConstruct00000004"
 +
Public_name "pCes1943"
 +
Summary "[rol-6(su1006)]
 +
 
 +
(New) Construct : "WBConstruct00000005"
 +
Public_name "pBluescript KS"
 +
</pre>
 +
 
 +
 
 +
===Expression objects with construct===
 +
 
 +
Examples of two expression objects pertaining to sequence feature
 +
 
 +
<pre>
 +
 
 +
Example 1:
 +
 
 +
Expr_pattern : "Expr11377"
 +
Anatomy_term "WBbt:0005813" Certain
 +
Anatomy_term "WBbt:0008588" Certain
 +
Anatomy_term "WBbt:0008589" Certain
 +
Gene "WBGene00001948"
 +
Life_stage "WBls:0000003"
 +
Life_stage "WBls:0000041"
 +
Pattern "enh-1 was preferentially active in the posterior C and D lineages
 +
in the embryo and in body wall musculature in the adult."
 +
Reference "WBPaper00032967"
 +
Reporter_gene
 +
Construct "WBConstruct00000020"
 +
Associated_feature "WBsf047531"
 +
 
 +
Construct : "WBConstruct00000020"
 +
Public_name "enh-1 reporter"  
 +
Summary "[hlh-1.enh-1::pPD107.94]"  
 +
Clone "pPD107.94"                    //added clone back to the construct model
 +
Sequence_feature "WBsf047531"
 +
Gene "WBGene00001948"
 +
Fusion_reporter "GFP"
 +
Construction_summary "Enhancer region enh-1 for hlh-1 cloned into the
 +
  (del)Pes-10 basal promoter vector pPD107.94"
 +
Reference "WBPaper00032967"
 +
 
 +
 
 +
 
 +
Example 2:
 +
 
 +
Expr_pattern : "Expr11284"
 +
Anatomy_term "WBbt:0006894"
 +
Gene "WBGene00001185"
 +
Pattern "The distal enhancer activity was observed in P6.p and its
 +
descendants from the two-cell stage and increased with time. Distal
 +
enhancer activity persisted into much later stages than the proximal
 +
enhancer did."
 +
Reference "WBPaper00005841"
 +
Reporter_gene
 +
Construct "WBConstruct00000021"
 +
Associated_feature "WBsf919543"
 +
 
 +
 
 +
Construct : "WBConstruct00000021"
 +
Public_name "[Distal egl-17 enhancer reporter]"
 +
Summary "[egl-17.distal::pPD122.53]"
 +
Clone "pPD122.53"                        //added clone back into model
 +
Sequence_feature "WBsf919543"
 +
Gene "WBGene00001185"
 +
Fusion_reporter "GFP"
 +
Construction_summary "Distal egl-17 enhancer inserted into the pPD122.53 vector."
 +
Reference "WBPaper00005841"
 +
 
 +
</pre>
 +
 
 +
 
 +
---------------------------------------------------
 +
 
 +
Expression objects described with reporter fusions that do not have a classical Ex transgene designation
 +
 
 +
<pre>
 +
 
 +
Expr_pattern : "Expr11598"
 +
Anatomy_term "WBbt:0003681" Certain
 +
Anatomy_term "WBbt:0005772" Certain
 +
Anatomy_term "WBbt:0006749" Certain
 +
Gene "WBGene00001753"
 +
Life_stage "WBls:0000023"
 +
Life_stage "WBls:0000041"
 +
Pattern "gst-5 was expressed in intestine, pharynx, and circumpharyngeal neurons.
 +
Expression is seen from L1 to adult stages."
 +
Reference "WBPaper00037704"
 +
Reporter_gene
 +
Construct "WBConstruct00000021"
 +
 
 +
 
 +
Construct : "WBConstruct00000021" 
 +
Public_name "Expr11598_Ex"  
 +
Summary "[GST-5::GFP]"
 +
Driven_by_gene "WBGene00001753"
 +
Gene "WBGene00001753"
 +
Fusion_reporter "GFP"
 +
Translational_fusion
 +
Reference "WBPaper00037704"
 +
</pre>
 +
 
 +
---------------------------------------------------
 +
 
 +
===Interaction/Regulation objects pertaining to construct===
 +
 
 +
Interaction/Regulation object contains sequence feature. I am not sure shall we add construct tag in our model? --Xiaodong
 +
 
 +
<pre>
 +
 
 +
Interaction : "WBInteraction000502404"
 +
Change_of_expression_level
 +
Interactor_overlapping_gene      "WBGene00004077" Trans_regulator
 +
Interactor_overlapping_gene      "WBGene00004077" Variation "WBVar00241166"
 +
Interactor_overlapping_gene      "WBGene00009560" Trans_regulated
 +
Interactor_overlapping_gene      "WBGene00009560" Expr_pattern "Expr4287"
 +
Feature_interactor      "WBsf034247" Cis_regulator
 +
Interaction_summary      "psa-3 expression was induced in T.p after the T cell division, and it accumulated in the posterior granddaughters. psa-3 expression in the T.p lineage was much lower in a pop-1 hypomorphic allele, q645."
 +
Reporter_gene    "[psa-3::gfp], translational fusion" //This information seems like it can be captured by transgene or construct now, I am missing why this tag is needed.
 +
//Xiaodong's comments: this tag has been in the model from the beginning. it's just curator's simple notes on reporter construct. if you notice, I don't even have the precise reporter description.
 +
//We can leave as it is now, and let user have a rough idea of what reporter looks like. if they want, they can go to check construct for detailed info.
 +
//If the construct model goes in, the webteam can port the construct summary to this interaction page, likewise with the transgene summary info. But I leave it to you.
 +
Construct       "WBConstruct00000021"
 +
Transcriptional
 +
Positive_regulate        Anatomy_term "WBbt:0006996"
 +
Positive_regulate        Anatomy_term "WBbt:0006997"
 +
Positive_regulate        Anatomy_term "WBbt:0007000"
 +
Positive_regulate        Anatomy_term "WBbt:0007007"
 +
Positive_regulate        Anatomy_term "WBbt:0007012"
 +
Positive_regulate        Anatomy_term "WBbt:0007016"
 +
Paper    "WBPaper00027741"Remark   "POP-1 function is known to be required in T.p to determine the neural fate. POP-1 regulates psa-3 expression in T.p through the POP-1 binding site."
 +
 
 +
 
 +
Construct : "WBConstruct00000021"
 +
Public_name "osEx113"
 +
Summary "[Ppsa-3::psa-3::gfp]"
 +
Construction_summary "psa-3 promoter and the entire coding region."
 +
Reporter_product "GFP"
 +
Driven_by_gene "WBGene00009560"
 +
Gene "WBGene00009560"
 +
Translational_fusion
 +
Reference "WBPaper00040473"
 +
Reference "WBPaper00027741"
 +
 
</pre>
 
</pre>

Latest revision as of 18:04, 23 September 2015

back to WormBase_Models

Model changes

WS251

Construct_for_disease	?DO_term	XREF	Associated_construct	#Evidence

Proposed model changes

Purpose: the technology of engineering mutations and gene replacement has been developed in C. elegans. With these new research tools, capture and display of the molecular information of these alleles needs to be updated. We propose a new class, Construct, to capture the specifics of the DNA tool used to perform the replacement or engineering, while the Variation model gets updated to record the engineering event itself and its impact on the genome. As a side benefit to the creation of the Construct model, we can use this new class to also capture the genomic arrays used create transgenes.

Variation

Proposed additions 

?Variation
Variation_type 
    Engineered_allele 
Variation_summary ?Text//to house final engineered construct
Derived_from ?Construct XREF Engineered_variation
Corresponing_transgene Unique ?Transgene XREF Corresponding_variation
Method 
    Homologous_recombination //Homologous_recombination
    NHEJ //Non-homologous DNA end-joining, imprecise DNA repair
    MosSci
    TALENs
    CRISPR_Cas9
    ZFN-NHEJ repair //Zinc-finger nuclease
    ZFN-HR repair
Expr_pattern ?Expr_pattern XREF Variation #Evidence

notes on variation model changes

see discussion tab

WBPaper00045772 Paix et al., 2014
Discusses Homology directed repair (HDR) vs Nonhomologous end-joining (NHEJ). It would seem that distinguishing the method used to create engineered alleles is important. However, the tags should perhaps be modified to distinguish double stranded break method and repair method. 

break_made_by
  Mos_excision
  CRISPR/Cas9
  TALENs
  Zinc_finger_endonuclease
  OTHER

repaired_by
  nonhomologous_end_joining_NHEJ
  homologous_direct_repair_HDR

repair_template
  Construct (note, ssODNs (single-strand oligonucleotides) should be added as a construct_type)


--Kyook (talk) 21:17, 16 October 2014 (UTC)

Construct (new)

Class itself is new 

?Construct Evidence #Evidence
	   Curator_confirmed	?Person
	   Public_name ?Text
	   Other_name ?Text
	   Summary ?Text                      //genotype like [Pmyo-2::GFP]
	   Sequence_feature ?Feature XREF Associated_with_construct
	   Driven_by_gene ?Gene XREF Drives_construct #Evidence
	   Gene ?Gene XREF Construct_product #Evidence
	   3_UTR ?Gene #Evidence
	   Fusion_reporter ?Text              //fluorescent proteins GFP, RFP, mCherry, etc.
	   Other_reporter ?Text               //to add reporters, tags that aren�-F¢t included in model�-A
	   Purification_tag ?Text             //FLAG, HA, Myc, TAP, etc.
	   Recombination_site ?Text           //LoxP, FRT
	   Type_of_construct  Chimera
			      Domain_swap
			      Engineered_mutation
			      Fusion
			      Complex                    // complex changes
			      Transcriptional_fusion
			      Translational_fusion
			      Nterminal_translational_fusion
			      Cterminal_translational_fusion
			      Internal_coding_fusion
	   Selection_marker ?Text
	   Construction_summary  ?Text        // Backbone vector, mol bio
	   DNA_text Text                      // for mapping, can include entire construct sequence
	   Clone ?Clone XREF Construct
	   Used_for Transgene_construct ?Transgene XREF Construct
		    Transgene_coinjection ?Transgene XREF Coinjection
		    Engineered_variation ?Variation XREF Derived_from_construct
		    Topic_output_indicator ?WBProcess XREF Marker_construct
		    Expression_pattern ?Expr_pattern XREF Construct
		    Interactor ?Interaction
	   Reference ?Paper
	   Person ?Person
	   Laboratory ?Laboratory #Lab_Location
	   Historical_gene ?Gene #Evidence
	   Remark ?Text #Evidence

notes on construct model

see discussion tab

#Interactor_info

 Construct ?Construct XREF Interactor

Interaction

 Unaffiliated_construct   ?Construct
 Detection_method    Construct

Expression_pattern

proposed addition 

Variation ?Variation XREF Expression_pattern
Construct ?Construct XREF Expression_pattern

Gene

proposed change 

Drives_Transgene ?Transgene XREF Driven_by_gene
change to 
Drives_construct ?Construct XREF Driven_by_gene

Transgene

Proposed changes: Many of the transgene tags have been moved to the proposed ?Construct model, the remaining tags as well as some additions are shown below 

?Transgene      Evidence #Evidence
		Public_name UNIQUE ?Text
		Summary UNIQUE ?Text
		Synonym ?Text
		Corresponding_variation UNIQUE ?Variation XREF Corresponding_transgene //put in to unambiguously associate the allele/transgene
		Construction Construct   ?Construct XREF Transgene_construct
     			     Coinjection ?Construct XREF Transgene_coinjection
     			     Coinjection_other ?Text //for coinjection markers that are not specified as a construct
     			     Integration_method UNIQUE ?Text
     			     Integrated_from ?Transgene XREF Transgene_derivation
     			     Laboratory ?Laboratory #Lab_Location
     			     Author ?Author
		Construction_summary ?Text
		Genetic_information Extrachromosomal
				    Integrated
				    Map ?Map  #Map_position  //needed for transgenes with no granular mapping, e.g., just mapped to a LG
                                    Mapping_data 2_point ?2_point_data      //deleted for WS245, rolled back for WS246
				    Map_evidence #Evidence
				    Phenotype ?Phenotype XREF Transgene #Phenotype_info
				    Phenotype_not_observed ?Phenotype XREF Not_in_Transgene #Phenotype_info
		Used_for Transgene_derivation ?Transgene XREF Integrated_from
			 Expr_pattern ?Expr_pattern XREF Transgene
			 Marker_for   ?Text #Evidence
			 Interactor ?Interaction
		Associated_with Marked_rearrangement ?Rearrangement XREF By_transgene
				Strain ?Strain XREF Transgene
		Reference ?Paper XREF Transgene
		Species UNIQUE ?Species
		Remark ?Text #Evidence
                Historical_gene   ?Gene #Evidence

WBProcess

    Marker_construct ?Construct XREF Topic_output_indicator

Test data

Variation objects with constructs

LP132 nmy-2(cp7[nmy-2::gfp + LoxP unc-119(+) LoxP]) I; unc-119(ed3) I

Variation : "WBVar020000000"
Public_name "cp7"
Engineered_allele 
Variation_summary "[nmy-2::gfp + LoxP unc-119(+) LoxP]"
Derived_from "WBConstruct00000010"
Derived_from "WBConstruct00000011"
Homologous_recombination

Construct : "WBConstruct00000010"
Summary "[nmy-2::gfp]
Driven_by_gene "WBGene00003777"
Fusion_reporter "GFP"
N-terminal_translational_fusion

Construct : "WBConstruct00000011"
Summary "[LoxP unc-119(+) LoxP]
Recombination_site "LoxP"
Gene "WBGene00003777"

bus-50(e5000[T110E]) = An engineered missense mutation

bus-50(e5001[bus-50::gfp]) aka bus-50::gfp = 
 An engineered fusion of GFP to the C-terminus of BUS-50

Variation : "WBVar0200000001"
Public_name "e5001"
Engineered_allele 
Variation_summary "[bus-50::gfp]"
Derived_from "WBConstruct00000012"
CRISPR-Cas9

Construct : "WBConstruct00000012"
Summary "[bus-50::gfp]"
Gene "WBGene0020000001"
Fusion_reporter "GFP"
C-terminal_translational_fusion


bus-50(e5002[bus-50::gfp + loxP unc-119(+) loxP]) 
 An engineered insertion of GFP plus the unc-119(+) selectable marker, flanked by loxP sites.

Variation : "WBVar020000003"
Public_name "e5002"
Engineered_allele 
Variation_summary "[bus-50::gfp + loxP unc-119(+) loxP]"
Derived_from "WBConstruct00000012"
Derived_from "WBConstruct00000011"
HR

Construct : "WBConstruct00000012"
Summary "[bus-50::gfp]"
Gene "WBGene0020000001"
Fusion_reporter "GFP"
C-terminal_translational_fusion


Construct : "WBConstruct00000011"
Summary "[LoxP unc-119(+) LoxP]
Recombination_site "LoxP"
Gene "WBGene00003777"


bus-50(e5003[bus-50::gfp +loxP]) aka bus-50(e5003) = 
 bus-50(e5002) following Cre-mediated recombinase removal of unc-119(+) leaving a single loxP site

Variation : "WBVar020000004"
Public_name "e5003"
Engineered_allele 
Variation_summary "[bus-50::gfp + loxP]"
Derived_from "WBConstruct00000012"
Derived_from "WBConstruct00000011"
HR

Construct : "WBConstruct00000012"
Summary "[bus-50::gfp]"
Gene "WBGene0020000001"
Fusion_reporter "GFP"
C-terminal_translational_fusion

Construct : "WBConstruct00000011"
Summary "[LoxP unc-119(+) LoxP]
Recombination_site "LoxP"
Gene "WBGene00003777"

Variation object with transgene

eIs2002 = eIs2002[unc-119::gfp] = eIs2002[unc-119::gfp, III:2992500]  
 Engineered insertions in apparent intergenic region with optional 
 descriptors (nature of the insertion or position in the genome)

Variation : "WBVar020000005"
Public_name "eIs2002"
Engineered_allele 
Variation_summary "[unc-119::gfp]"
Derived_from "WBConstruct00000013"
Identical_transgene "WBTransgene00024514"
MosSci

Construct : "WBConstruct00000013"
Summary "[unc-119::gfp]"
Gene "WBGene0020000001"
Fusion_reporter "GFP"
Translational_fusion

Transgene : "WBTransgene00024514"
Public_name "eIs2002"
Summary "[unc-119::GFP]"
Construct "WBConstruct00000013"


ozIs909, or ozIs909[unc-119::mCherry *eIs2002] = 
  Engineered changes to existing Is (or Si) insertions, which should 
  receive new Is numbers using originating lab’s prefix. The original 
  Is insertion is indicated in brackets with a preceding asterisk (*), 
  in order to allow searches for all derivatives from a given insertion. 
  In this case, an engineered change from GFP to mCherry in eIs2002

Variation : "WBVar020000006"
Public_name "ozIs909"
Engineered_allele 
Variation_summary "[unc-119::mCherry *eIs2002]"
Derived_from "WBConstruct00000015"
Identical_transgene "WBTransgene00024515"
MosSci

Construct : "WBConstruct00000015"
Summary "[unc-119::mCherry]"
Gene "WBGene0020000001"
Fusion_reporter "mCherry"
Translational_fusion

Transgene : "WBTransgene00024515"
Public_name "ozIs909"
Summary "[unc-119::mCherry]
Construct "WBConstruct00000015"

Transgene with construct

The following depicts how current transgenes would be redistributed into the proposed Construct and Transgene models 

(Original)Transgene : "WBTransgene00000001"
Public_name	"adEx1256"
Summary	"[egl-19::sGFP-NLS + lin-15(+)]"
Reporter_product	"GFP"
Driven_by_gene	"WBGene00001187"
Strain	"DA1256"
Reference	"WBPaper00029359"
Reporter_type	"Transcriptional fusion"
Synonym	"[C48A7.1::gfp]"


(New)Transgene : "WBTransgene00000001"
Public_name	"adEx1256"
Summary	"[egl-19::sGFP-NLS + lin-15(+)]"
Construct "WBConstruct00000001"
Coinjection_other "lin-15(+)"
Extrachromosomal
Strain	"DA1256"
Reference	"WBPaper00029359"

(New)Construct : WBConstruct00000001
Public_name	"adEx1256"
Other_name	"[C48A7.1::gfp]"
Summary	"[egl-19::sGFP-NLS]"
Fusion_reporter	"GFP"
Driven_by_gene	"WBGene00001187"
Reference	"WBPaper00029359"
Transcriptional_fusion


(Original)Transgene : "WBTransgene00000011"
Public_name	"adIs1240"
Summary	"[lin-15(+) eat-4::sGFP]"
Reporter_product	"GFP"
Driven_by_gene	"WBGene00001135"
Strain	"DA1240"
Strain	"DA1243"
Map	"X"
Map_evidence	Paper_evidence	"WBPaper00038205"
Reference	"WBPaper00030960"
Reference	"WBPaper00032252"
Reference	"WBPaper00035265"
Reference	"WBPaper00036277"
Reference	"WBPaper00036704"
Reference	"WBPaper00037626"
Reference	"WBPaper00038205"
Reference	"WBPaper00044482"
Synonym	"[eat-4::gfp]"

(New)Transgene : "WBTransgene00000011"
Public_name	"adIs1240"
Summary	"[lin-15(+) eat-4::sGFP]"
Strain	"DA1240"
Strain	"DA1243"
Map	"X"
Map_evidence	Paper_evidence	"WBPaper00038205"
Coninjection_other "lin-15(+)"
Reference	"WBPaper00030960"
Reference	"WBPaper00032252"
Reference	"WBPaper00035265"
Reference	"WBPaper00036277"
Reference	"WBPaper00036704"
Reference	"WBPaper00037626"
Reference	"WBPaper00038205"
Reference	"WBPaper00044482"

(New)Construct : "WBConstruct00000011"
Public_name	"adIs1240"
Other_name	"[eat-4::gfp]"
Summary	"[eat-4::sGFP]"
Fusion_reporter	"GFP"
Driven_by_gene	"WBGene00001135"
Reference	"WBPaper00030960"


(Original) Transgene : "WBTransgene00000017"
Public_name	"ajIs1"
Summary	"[pgp-5::gfp]"
Coinjection_marker	"pRF4[rol-6(su1006)]"
Construction_summary	"Integrated from BC10030 sEx864."
Reporter_product	"GFP"
Driven_by_gene	"WBGene00003999"
Driven_by_gene	"WBGene00006767"
Integration_method	"Gamma_ray"
Integrated
Reference	"WBPaper00002968"
Reference	"WBPaper00031023"

(New) Transgene : "WBTransgene00000017"
Public_name	"ajIs1"
Integration_method	"Gamma_ray"
Integrated
Reference	"WBPaper00002968"
Reference	"WBPaper00031023"
Integrated_from "WBTransgene00002030"
Construction_summary	"Integrated from BC10030 sEx864."

(New) Transgene : "WBTransgene00002030"
Public_name "sEx864"
Synonym "[pgp-5::gfp]"
Synonym	"[C05A9.1::gfp]"
Summary "[rCesC05A9.1::GFP + pCeh361]"
Extrachromosomal
Construct "WBConstruct00000017"
Construct "WBConstruct00000018"
Construct "WBConstruct00000002"

(New) Construct : "WBConstruct00000018"
Public_name "pRF4"
Summary "[rol-6(su1006)]"
Gene "WBGene00004397"

(New) Construct : "WBConstruct00000017"
Public_name "[pgp-5::gfp]"
Summary	"[rCesC05A9.1::GFP]"
Reporter_product	"GFP"
Transcriptional_fusion
Driven_by_gene	"WBGene00003999"

(New) Construct : "WBConstruct00000002"
Public_name "pCeh361"
Summary "[pCeh::DPY-5]"
Clone "pGEM-5
Construction_summary "A 3.3-kb Nco I fragment containing a predicted cuticle 
  collagen gene was isolated from the cosmid F27C1, and cloned into the Nco I 
  site of pGEM-5 to generate the clone pCeh361"
Reference	"WBPaper00027361"

(New) Transgene : "WBTransgene00000600"
Public_name	"hIs2"
Summary	"[DPY-5::GFP + rol-6(su1006) + pBluescript]
Construct  "WBConstruct00000003"//pCeh358
Coinjection "WBConstruct00000004"//PCes1943
Coinjection "WBConstruct00000005"//pBluescript KS
Construction_summary	"Transgenic animals were generated by microinjection of 
  pCeh358 (5 ng/ul) and pBluescript KS (100 ng/ul), or in combination with 50 ng/ul 
  pCes1943, which carries a dominant rol-6 mutation [rol-6(su1006)] used as a 
  morphological marker for successful transformation"

(New) Construct : "WBConstruct00000003"
Public_name	"pCeh358"
Summary	"[dpy-5::gfp]"
Driven_by_gene	"WBGene00001067"
Gene	"WBGene00001067"
Clone "pPD95.69"
Translational_fusion
Construction_summary	"The dpy-5::gfp reporter construct pCeh358 was 
  generated by insertion of a 750 bp Sph I fragment from pCeh361 into the 
  Sph I site of the gfp expression vector pPD95.69 (kindly provided by A. Fire). 
  This fragment contains 5' sequences from an Sph I site in the polylinker of 
  pCeh361 to a site 30 bp downstream from the predicted DPY-5 initiator methionine, 
  resulting in an in-frame fusion of the first 12 codons of dpy-5 with gfp."
Reference	"WBPaper00027361"

(New) Construct : "WBConstruct00000004"
Public_name	"pCes1943"
Summary "[rol-6(su1006)]

(New) Construct : "WBConstruct00000005"
Public_name	"pBluescript KS"


Expression objects with construct

Examples of two expression objects pertaining to sequence feature 


Example 1:

Expr_pattern : "Expr11377"
Anatomy_term	"WBbt:0005813" Certain
Anatomy_term	"WBbt:0008588" Certain
Anatomy_term	"WBbt:0008589" Certain
Gene	"WBGene00001948"
Life_stage	"WBls:0000003"
Life_stage	"WBls:0000041"
Pattern	"enh-1 was preferentially active in the posterior C and D lineages 
 in the embryo and in body wall musculature in the adult."
Reference	"WBPaper00032967"
Reporter_gene
Construct	"WBConstruct00000020"
Associated_feature "WBsf047531"

Construct : "WBConstruct00000020"
Public_name "enh-1 reporter"  
Summary	"[hlh-1.enh-1::pPD107.94]"  
Clone "pPD107.94"                     //added clone back to the construct model
Sequence_feature "WBsf047531"
Gene	"WBGene00001948"
Fusion_reporter	"GFP"
Construction_summary "Enhancer region enh-1 for hlh-1 cloned into the 
 (del)Pes-10 basal promoter vector pPD107.94"
Reference	"WBPaper00032967"



Example 2:

Expr_pattern : "Expr11284"
Anatomy_term	"WBbt:0006894"
Gene	"WBGene00001185"
Pattern	"The distal enhancer activity was observed in P6.p and its 
 descendants from the two-cell stage and increased with time. Distal 
 enhancer activity persisted into much later stages than the proximal 
 enhancer did."
Reference	"WBPaper00005841"
Reporter_gene
Construct	"WBConstruct00000021"
Associated_feature "WBsf919543"


Construct : "WBConstruct00000021"
Public_name "[Distal egl-17 enhancer reporter]" 
Summary	"[egl-17.distal::pPD122.53]" 
Clone "pPD122.53"                        //added clone back into model
Sequence_feature "WBsf919543"
Gene	"WBGene00001185"
Fusion_reporter	"GFP"
Construction_summary "Distal egl-17 enhancer inserted into the pPD122.53 vector."
Reference	"WBPaper00005841"


Expression objects described with reporter fusions that do not have a classical Ex transgene designation 


Expr_pattern : "Expr11598"
Anatomy_term	"WBbt:0003681" Certain
Anatomy_term	"WBbt:0005772" Certain
Anatomy_term	"WBbt:0006749" Certain
Gene	"WBGene00001753"
Life_stage	"WBls:0000023"
Life_stage	"WBls:0000041"
Pattern	"gst-5 was expressed in intestine, pharynx, and circumpharyngeal neurons. 
 Expression is seen from L1 to adult stages."
Reference	"WBPaper00037704"
Reporter_gene	 
Construct	"WBConstruct00000021"


Construct : "WBConstruct00000021"  
Public_name	"Expr11598_Ex"  
Summary	"[GST-5::GFP]"
Driven_by_gene	"WBGene00001753"
Gene	"WBGene00001753"
Fusion_reporter	"GFP"
Translational_fusion
Reference	"WBPaper00037704"

Interaction/Regulation objects pertaining to construct

Interaction/Regulation object contains sequence feature. I am not sure shall we add construct tag in our model? --Xiaodong 


Interaction : "WBInteraction000502404"
Change_of_expression_level
Interactor_overlapping_gene      "WBGene00004077" Trans_regulator
Interactor_overlapping_gene      "WBGene00004077" Variation "WBVar00241166"
Interactor_overlapping_gene      "WBGene00009560" Trans_regulated
Interactor_overlapping_gene      "WBGene00009560" Expr_pattern "Expr4287"
Feature_interactor       "WBsf034247" Cis_regulator
Interaction_summary      "psa-3 expression was induced in T.p after the T cell division, and it accumulated in the posterior granddaughters. psa-3 expression in the T.p lineage was much lower in a pop-1 hypomorphic allele, q645."
Reporter_gene    "[psa-3::gfp], translational fusion"  //This information seems like it can be captured by transgene or construct now, I am missing why this tag is needed. 
//Xiaodong's comments: this tag has been in the model from the beginning. it's just curator's simple notes on reporter construct. if you notice, I don't even have the precise reporter description. 
//We can leave as it is now, and let user have a rough idea of what reporter looks like. if they want, they can go to check construct for detailed info.
//If the construct model goes in, the webteam can port the construct summary to this interaction page, likewise with the transgene summary info. But I leave it to you.
Construct       "WBConstruct00000021"
Transcriptional 
Positive_regulate        Anatomy_term "WBbt:0006996"
Positive_regulate        Anatomy_term "WBbt:0006997"
Positive_regulate        Anatomy_term "WBbt:0007000"
Positive_regulate        Anatomy_term "WBbt:0007007"
Positive_regulate        Anatomy_term "WBbt:0007012"
Positive_regulate        Anatomy_term "WBbt:0007016"
Paper    "WBPaper00027741"Remark   "POP-1 function is known to be required in T.p to determine the neural fate. POP-1 regulates psa-3 expression in T.p through the POP-1 binding site."


Construct : "WBConstruct00000021"
Public_name "osEx113"
Summary	"[Ppsa-3::psa-3::gfp]"
Construction_summary	"psa-3 promoter and the entire coding region."
Reporter_product	"GFP"
Driven_by_gene	"WBGene00009560"
Gene	"WBGene00009560"
Translational_fusion
Reference	"WBPaper00040473"
Reference	"WBPaper00027741"
Retrieved from "https://wiki.wormbase.org/index.php?title=WormBase_Model:Construct&oldid=27829"