WS177
From WormBaseWiki
Jump to navigationJump to search
Release Notes
New release of WormBase WS177, Wormpep177 and Wormrna177 Fri Jun 15 15:39:40 BST 2007 WS177 was built by Michael Han ====================================================================== This directory includes: i) database.WS177.*.tar.gz - compressed data for new release ii) models.wrm.WS177 - the latest database schema (also in above database files) iii) CHROMOSOMES/subdir - contains 3 files (DNA, GFF & AGP per chromosome) iv) WS177-WS176.dbcomp - log file reporting difference from last release v) wormpep177.tar.gz - full Wormpep distribution corresponding to WS177 vi) wormrna177.tar.gz - latest WormRNA release containing non-coding RNA's in the genome vii) confirmed_genes.WS177.gz - DNA sequences of all genes confirmed by EST &/or cDNA viii) cDNA2orf.WS177.gz - Latest set of ORF connections to each cDNA (EST, OST, mRNA) ix) gene_interpolated_map_positions.WS177.gz - Interpolated map positions for each coding/RNA gene x) clone_interpolated_map_positions.WS177.gz - Interpolated map positions for each clone xi) best_blastp_hits.WS177.gz - for each C. elegans WormPep protein, lists Best blastp match to human, fly, yeast, C. briggsae, and SwissProt & TrEMBL proteins. xii) best_blastp_hits_brigprot.WS177.gz - for each C. briggsae protein, lists Best blastp match to human, fly, yeast, C. elegans, and SwissProt & TrEMBL proteins. xiii) geneIDs.WS177.gz - list of all current gene identifiers with CGC & molecular names (when known) xiv) PCR_product2gene.WS177.gz - Mappings between PCR products and overlapping Genes Release notes on the web: ------------------------- http://www.wormbase.org/wiki/index.php/Release_notes Genome sequence composition: ---------------------------- WS177 WS176 change ---------------------------------------------- a 32365888 32365889 -1 c 17779856 17779856 +0 g 17756017 17756016 +1 t 32365689 32365689 +0 Total 100267450 100267450 Chromosomal Changes: -------------------- Chromosome: I 7301405 7301404 0 -> 7301405 7301405 1 9606432 9606431 0 -> 9606433 9606433 1 Chromosome: III 9778413 9778413 1 -> 9778413 9778412 0 9863640 9863639 0 -> 9863639 9863639 1 Chromosome: V 10766209 10766209 1 -> 10766209 10766208 0 Chromosome: X 11848274 11848274 1 -> 11848274 11848273 0 Gene data set (Live C.elegans genes 24123) ------------------------------------------ Molecular_info 22418 (92.9%) Concise_description 4732 (19.6%) Reference 7097 (29.4%) CGC_approved Gene name 9279 (38.5%) RNAi_result 19875 (82.4%) Microarray_results 19569 (81.1%) SAGE_transcript 0 (0%) Wormpep data set: ---------------------------- There are 20140 CDS in autoace, 23412 when counting 3272 alternate splice forms. The 23412 sequences contain 10,288,612 base pairs in total. Modified entries 52 Deleted entries 0 New entries 62 Reappeared entries 2 Net change +64 Status of entries: Confidence level of prediction (based on the amount of transcript evidence) ------------------------------------------------- Confirmed 8020 (34.3%) Every base of every exon has transcription evidence (mRNA, EST etc.) Partially_confirmed 10747 (45.9%) Some, but not all exon bases are covered by transcript evidence Predicted 4645 (19.8%) No transcriptional evidence at all Status of entries: Protein Accessions ------------------------------------- UniProtKB/Swiss-Prot accessions 3544 (15.1%) UniProtKB/TrEMBL accessions 19448 (83.1%) Status of entries: Protein_ID's in EMBL --------------------------------------- Protein_id 22992 (98.2%) Gene <-> CDS,Transcript,Pseudogene connections (cgc-approved) --------------------------------------------- Entries with CGC-approved Gene name 7641 GeneModel correction progress WS176 -> WS177 ----------------------------------------- Confirmed introns not in a CDS gene model; +---------+--------+ | Introns | Change | +---------+--------+ Cambridge | 0 | -70 | St Louis | 0 | -179 | +---------+--------+ Members of known repeat families that overlap predicted exons; +---------+--------+ | Repeats | Change | +---------+--------+ Cambridge | 0 | -6 | St Louis | 0 | -6 | +---------+--------+ Synchronisation with GenBank / EMBL: ------------------------------------ CHROMOSOME_V sequence Z72508 CHROMOSOME_X sequence Z67755 There are no gaps remaining in the genome sequence --------------- For more info mail worm@sanger.ac.uk -===================================================================================- New Data: --------- New orthology data from user submissions was added and curated. EnsEMBL orthologues from EnsEMBL-compara release 44 were imported to update the ortholog_other EnsEMBL data. Large increases of Anatomy_term and Anatomy_name have been made in order to clearly distinguish the identity of a cell (e.g. ABalapp) from its nucleus (e.g. ABalapp nucleus). Transcript alignment data from non C.elegans Caenorhabditis species (C.briggsae / C. brenneri / C.remanei / C.japonica) to the C.elegans genome was added to WormBase. Genome sequence updates: ----------------------- 7 changes were made to the genome sequence: F54F7 deletion tagctcaccagcttgcacgGgaagtgaaagtcttgaaata F28H7 deletion aacaaaatcttgcaactagTaatgtgaaaaagtgtggact K07A1 insertion ttctcaaatttcagtttatTggaacattacaaatatgtgt F13G3 insertion tttttttcagacaccgttcgtttggctccgGcgcgatcaacatggtgatggttgcacaagg R10E11 deletion gccacctggaaatcaatcagctcctcaaaaAgaattccgaatctgcctatattctgttcta K11H3 insertion gcattaacaacacacggaaatcgaaatggaCcacttcgttatagtcttcttcaacaacgag Y95D11A shift-overlap GTTATATATTTTTTTGGAAATTTATAACTCTTAAAAAAATTCAATTTTTTCAAATAAATAAAATTTCAGATGGCTTCTCAACCGGAGCTCATAATGGTTG ACGAGCAAGTCGTCGCTTATGAAGTAGAAATTGATAGTTTTGATGTAAAATATGATGAAGAGGAACATGATGGTCAAGGGACACAAGATGAACCATTTTC TCATGGTACGGAACAGTTTTACGCTGAAAAATTCCAGAATTCCAAAAAATGAAACCTAAAATAGTGATAAAAAGGCGTTTTGAATATTAAATTGAAGAAA AAAATCAGCAAAAATTGTTCAAAATCAAGAATTTTAACGGAAAAGTGTAAAATCTTCTCCACGGGGAGTACACATGCTTCGTAAATCGACATATGGTCAA TTTTAAAGTTTTGAAAATTGAAATGCCGGCAAAAAATCTTTTCTTGTTTTTTTTTCGCAAAAAATTCAATTTTCGAAAAAATAATTATAGAAAATTGCAT TTTTTGACCGAAAAGTCAATAAAAATAACAGAAAAAATCGATAAACCGTTGAAAAATTTTTTTTTAATTCAAAAATTCAGAAATTCTTAAAATTCAAATT TCCAGATGAGCCAAGCACCAGCGGTTATCACCATCACTACCAATTTCCCAATGACGTGGATCCAAATGATGTTTATTTATTCGATGAGGTATCAATTATC CGAAATTTGGCGATTTTTGAGCCAAAACTACGGTACCCGGTCTCGACACGACAATTTTTGTTAAATTAAAAAAGGTGTGCGCCTTTGAAGGTTACTGTAG TTTCGAACTTTTGCTGATTTTTCATATTTTTTCGTTGAAAACAAAAGTATTTATTTGTTGAAAATCAGAAAATATTATCTTCGCGTCGAGACCTATTACC ATTCTATTTTTGCCGCAAAAAACAAAATTTCCTTTAAAAAAAAGCTAATTTTTCCAAGTTTTTCCAGGAAACTGATCAAATTCATCAGCTCGACCCGAAT CAACTCAAAAATAATGAAGAAATTGACGATGTCGAATATATTGATCAATCTGTGCCTTCCACGTCATCAATGATGACGTCACTGCCGTCAACGGTGGCTC CAGTTCAGCCAAATACGTATTACAGACGGAAATCTGGAGGCCCAACTGCAACTGGAAATGAAAAACCGAATTATAGGCCGTTGGCGTTCCAAACGGTTCG taaaataaaaaaaatgtccatgtgtcgatt New Fixes: ---------- Known Problems: --------------- Other Changes: -------------- Proposed Changes / Forthcoming Data: ------------------------------------- Additional genome changes are planned for WS178. Model Changes: ------------------------------------ -===================================================================================- Quick installation guide for UNIX/Linux systems ----------------------------------------------- 1. Create a new directory to contain your copy of WormBase, e.g. /users/yourname/wormbase 2. Unpack and untar all of the database.*.tar.gz files into this directory. You will need approximately 2-3 Gb of disk space. 3. Obtain and install a suitable acedb binary for your system (available from www.acedb.org). 4. Use the acedb 'xace' program to open your database, e.g. type 'xace /users/yourname/wormbase' at the command prompt. 5. See the acedb website for more information about acedb and using xace. ____________ END _____________
known errors and fixes
missing landmarks
The GFF files for Chromosome II,III,IV,V,X are missing landmark entries. A patchfile for the missing landmark is available at ftp://ftp.sanger.ac.uk/pub2/wormbase/WS177/landmark_patch.gff.gz </nowiki>