Search results

Create the page "PCR product" on this wiki! See also the search results found.

• PMID:26412237
  |RT-PCR of embryonic mRNA identified two ulp-2 isoforms; ulp-2a, which is expressed |Rule of thumb for GO - is the gene product '''part of''' the process or does it '''regulate''' the process?
  16 KB (1,999 words) - 18:24, 28 October 2015
• Gene Interaction/archive
  ...ve // The multiplicative neutrality function defines expectation as the product of two quantified phenotypes (relative to wild type) Also, CDS and Gene, when overlapping, have #Evidence, but the PCR and Sequence do not. Why is this? Does it have to do with needing to indi
  50 KB (5,228 words) - 15:10, 21 July 2017
• Tasks in Progress
  ****Changed these Interaction relationships to "Associated Product" ***Ported and corrected e-PCR tool as well
  29 KB (4,254 words) - 20:25, 27 April 2012
• OA forms, tables, scripts, etc
  ...ge<br> Phenotype<br> Molecule<br> Person<br> Strain<br> Laboratory<br> PCR Product<br> ||/home/postgres/work/citace_upload/rnai/get_rnai_ace.pm<br> (Required
  20 KB (3,050 words) - 21:01, 19 April 2017
• Transgenes
  * gene product(s) ...eparate the two sequences. If you have primers you can use the WormBase e-PCR tool located here." Note: the e-PRC tool link is http://www.wormbase.org/t
  29 KB (4,575 words) - 16:23, 3 March 2022
• Gene Expression micropublications
  guidelines for gene product localization experiments assessed with reporter gene fusions. ...made using plasmid pPD95.75 as parent vector, and a fusion of a long range PCR fragment of genomic pkd-2 (promoter and 5'-end) with a 3'-end fragment deri
  21 KB (3,194 words) - 02:08, 17 May 2018
• WS244 Models.wrm
  ...ve // The multiplicative neutrality function defines expectation as the product of two quantified phenotypes (relative to wild type) ...// The multiplicative neutrality function defines expectation as the product of two quantified phenotypes (relative to wild type)
  235 KB (23,325 words) - 10:33, 3 July 2014
• Mapped Transgenes
  ...into the GFP plasmid pPD95.85, cut with XmaI and KpnI. The vit-2 gene was PCR amplified with primers V2F (TCCCCCCGGGTCCACGGACATTTCTGGGTCATTTG) and V2R (C ...of the PCR product and the plasmid pAZ132 with SpeI, ligation of the pgl-1 product and the SpeI fragment of pAZ132 bearing unc-119(+) and pie-1::gfp sequences
  397 KB (64,724 words) - 09:57, 7 July 2020
• Searching WormBase for Information About C. elegans (Wiley)
  ...s, or molecular clones spanning a defined chromosomal interval; electronic PCR; finding expression patterns, and the cell types or developmental origins f ...n available: identity of the gene's product; normal function of the gene's product; orthologs of the gene (if any); the gene's meiotic and physical location w
  103 KB (16,375 words) - 23:39, 30 November 2010
• FAQs
  | Plasmid: PCR clones ...jj_Y41D4A_2491.a_b ; Oligo: sjj_Y41D4A_2491.a_f) fails to produce an ePCR product and each individually fails to map to the genome when searched with Genome
  67 KB (10,954 words) - 09:22, 19 February 2013

View (previous 20 | next 20) (20 | 50 | 100 | 250 | 500)