Search results

Create the page "Contained in and Contains" on this wiki! See also the search results found.

• TAIR CCC
  ...a search on all papers in the Textpresso for Arabidopsis corpus published in 2008. '''After the initial trial run, Tanya realized that there are papers included in the corpus that describe experiments from other organisms that would not li
  24 KB (3,814 words) - 18:31, 8 August 2011
• Textpresso
  First two items cover general tool and website feature requests. Then, curation pipelines for each datatype ...line description'', ''postgres query'', ''requests'', ''false positives'' and ''false negatives''.
  17 KB (2,401 words) - 22:36, 29 November 2017
• CCC Form 2.0 Specifications
  ...are also part of the broader plan for Textpresso-based curation pipelines and the GO's Common Annotation Framework. #Recording curator or group and date of search
  30 KB (4,868 words) - 14:50, 11 June 2013
• Progress Report 2011
  =='''Methods and Strategies for Annotation'''== ...ators can query and sort the list according to reference count, gene name, and curation status.
  13 KB (1,830 words) - 16:40, 13 December 2012
• FAQs
  see [[Citing and Acknowledging WormBase|Citing and Acknowledging WormBase]]<br> ...ACeDB can be accessed both remotely and locally, through both commandline and web server.
  67 KB (10,954 words) - 09:22, 19 February 2013
• Updating WormBase
  ...the system is configured correctly, you should not need to be a root user in order to update the site. <nowiki>*** Potential stumbling blocks are indented and hilighted with a
  34 KB (5,450 words) - 18:24, 17 August 2010
• Antibody
  3. check "antibody" and "str flags cur_strdata" The string matching pipeline will run on a daily cronjob and will process 50 paper per day.
  21 KB (2,888 words) - 19:58, 9 April 2021
• Paper Tables in Postgres
  =List of Paper Tables in Postgres (Alphabetical)= Contains the affiliation (location) of one or more authors of the paper, meeting abs
  25 KB (3,238 words) - 16:42, 8 November 2019
• Administration:Installing WormMine
  ''This document describes how to install and configure the Intermine instance at WormBase. <span style="color: red">'''Work towards staging and production should be carried out as "intermine" user (<code>sudo su - inter
  25 KB (3,652 words) - 23:06, 25 December 2014
• Unused Attributes
  The following attributes are unused in the current Datomic-based DB prototype. It seems likely that many of them | :analysis/species-in-analysis
  35 KB (4,174 words) - 10:52, 2 February 2015
• Tasks in Progress
  **Documenting elements of WormBase workflow to ease transition for new staff and keep track of changes made **Added diagram and explanation for Tools data loading
  29 KB (4,254 words) - 20:25, 27 April 2012
• ISB2014 Session3 Functional Annotations
  ...me take collaborative notes on this session! Fill out your name in the box in the top right-hand corner. Add yourself to the editors list, then edit away .... In addition, the experimental analysis showed our approaches were robust in both the two tasks.
  25 KB (3,541 words) - 19:14, 11 April 2014
• FP curator comments for St.Louis and Sanger structure correction data type
  ...-6 untilizes different modes of splicing, see primer extension experiments in the article. ||2/2/02 21:01 | 2050||cdNA for unc-51 was isolated and sequenced but accession number was not given. ||2/2/02 21:01
  40 KB (4,083 words) - 23:02, 13 August 2010
• Mapped Transgenes
  ...and V2R (CGGGGTACCAGATAAGCGACGCAGGCGGTTGGGAC), containing engineered XmaI and KpnI sites, using cosmid DNA (C42D8) as a template. V2B3, at 50 ug/ml, was ...d the SpeI fragment of pAZ132 bearing unc-119(+) and pie-1::gfp sequences, and bombardment of the ligated DNA into unc-119(ed3) worms. || GFP || [http://w
  397 KB (64,724 words) - 09:57, 7 July 2020
• Molecule
  ...We provide links to other databases that deal with these molecule entities in greater detail. ** metabolite (primary and secondary)
  50 KB (6,966 words) - 19:15, 13 August 2020
• Pictures
  ...sion data from the literature and individual laboratories and display them in the WormBase gene expression page. ...oral or spatial (e.g., tissue, subcellular, etc.) localization of any gene in a wild-type background with different data types
  120 KB (19,719 words) - 16:44, 20 October 2023

View (previous 20 | next 20) (20 | 50 | 100 | 250 | 500)