Difference between revisions of "Sequence Feature"
Line 64: | Line 64: | ||
== Link to Expression pattern == | == Link to Expression pattern == | ||
− | + | How do we link sequence features to Expression Pattern objects. | |
− | + | ===current pipeline=== | |
+ | Authors generated a transcriptional fusion (e.g.: the promoter of egl-1 (~2kb upstream the ATG) was fused to GFP | ||
+ | |||
+ | |||
+ | |||
+ | The way Expression objects are currently curated is as follows. | ||
+ | |||
+ | * | ||
* Immunohistochemistry and ''in situ'' hybridization | * Immunohistochemistry and ''in situ'' hybridization | ||
* GFP reporter fusions | * GFP reporter fusions | ||
+ | |||
+ | |||
+ | As of now few Expression Patterns are linked to the Genome Browser (Vancouver set is the only data set). The ultimate goal is to map, whenever we can, expression constructs to the genome browser. |
Revision as of 09:05, 30 July 2013
Contents
Rules for marking up regions
- If a region is necessary and sufficient to drive a reporter gene, then mark it as an 'enhancer' or 'silencer'.
- If a region is both an enhancer and a silencer, then it should have the SO_term tags for both of these.
- If mobility shift experiments or similar experimental evidence is available to assert that a short region is a TF binding site, then mark it as a TF_binding_site.
- Similarity to a known binding motif is not evidence of being a TF_binding_site.
- If there is no evidence for a TF binding site and it has an effect on expression when mutated or deleted, but is not sufficient to drive a reporter gene, then we cannot assert that it is an enhancer or a TF binding site. Mark it as an anonymous 'regulatory_region'.
- If a region has the properties of being both a TF binding site and an enhancer then mark it up as two Features, one a TF_binding_site and one an enhancer.
- If a region is asserted to be a promoter region in the paper and it is within 200bp (or thereabouts?) of the 5' of the target gene and it is neccessary and sufficient to promote a reporter gene, mark it as a promoter. If in doubt, consider marking it as an enhancer.
Example for sequence feature curation
the example is from WBPaper00003631
Feature : "egl-1_temp_1.1" Sequence VF23B12L Mapping_target VF23B12L Flanking_sequences cagctcaattattaaattttattgggtattgttta cataaaattctattgtcccagatttaggatacatcg DNA_text CTCCTAACCGGGTGGTC Description "This is a TRA-1 binding site that represses egl-1." Remark "This is the TF_binding_site for TRA-1 which silences egl-1. N.B. a 'silencer' Feature has also been made at this location to aid expression and interaction curation [2013-07-23 gw3]" Associated_with_gene WBGene00001170 // egl-1 Bound_by_product_of WBGene00006604 // tra-1 Transcription_factor WBTranscriptionFactor000029 // tra-1 Method TF_binding_site SO_term "SO:0000235" // TF_binding_site Defined_by_paper WBPaper00003631 Public_name "TRA-1 binding site" Feature : "egl-1_temp_1.2" Sequence VF23B12L Mapping_target VF23B12L Flanking_sequences cagctcaattattaaattttattgggtattgttta cataaaattctattgtcccagatttaggatacatcg DNA_text CTCCTAACCGGGTGGTC Description "This is the silencer of egl-1, containing a single TF_binding_site bound by TRA-1." Remark "Made this 'silencer' feature in addition to the TRA-1 TF_binding_site Feature to aid expression and interaction curation [2013-07-23 gw3]" Associated_with_gene WBGene00001170 // egl-1 Method silencer SO_term "SO:0000625" // silencer Defined_by_paper WBPaper00003631 Public_name "TRA-1 binding site silencer"
Most Expr_pattern and Interaction objects will be attached to the 'enhancer/silencer' Features rather than the TF_binding_site Features
Link to Gene Regulation/Regulatory interaction
A regulatory interaction object has been generated
//Associated_with_interaction WBInteraction000520178
This will be added to the Sequence feature.
Link to Expression pattern
How do we link sequence features to Expression Pattern objects.
current pipeline
Authors generated a transcriptional fusion (e.g.: the promoter of egl-1 (~2kb upstream the ATG) was fused to GFP
The way Expression objects are currently curated is as follows.
- Immunohistochemistry and in situ hybridization
- GFP reporter fusions
As of now few Expression Patterns are linked to the Genome Browser (Vancouver set is the only data set). The ultimate goal is to map, whenever we can, expression constructs to the genome browser.