Difference between revisions of "Sequence Feature"

From WormBaseWiki
Jump to navigationJump to search
Line 18: Line 18:
 
=== Example for sequence feature curation ===
 
=== Example for sequence feature curation ===
  
 +
<pre>
  
 
Feature : "egl-1_temp_1.1"
 
Feature : "egl-1_temp_1.1"
Line 46: Line 47:
 
Defined_by_paper WBPaper00003631
 
Defined_by_paper WBPaper00003631
 
Public_name "TRA-1 binding site silencer"
 
Public_name "TRA-1 binding site silencer"
 +
 +
</pre>
  
 
== Link to Expression pattern ==
 
== Link to Expression pattern ==

Revision as of 08:45, 30 July 2013

Rules for marking up regions

  • If a region is necessary and sufficient to drive a reporter gene, then mark it as an 'enhancer' or 'silencer'.
  • If a region is both an enhancer and a silencer, then it should have the SO_term tags for both of these.
  • If mobility shift experiments or similar experimental evidence is available to assert that a short region is a TF binding site, then mark it as a TF_binding_site.
  • Similarity to a known binding motif is not evidence of being a TF_binding_site.
  • If there is no evidence for a TF binding site and it has an effect on expression when mutated or deleted, but is not sufficient to drive a reporter gene, then we cannot assert that it is an enhancer or a TF binding site. Mark it as an anonymous 'regulatory_region'.
  • If a region has the properties of being both a TF binding site and an enhancer then mark it up as two Features, one a TF_binding_site and one an enhancer.
  • If a region is asserted to be a promoter region in the paper and it is within 200bp (or thereabouts?) of the 5' of the target gene and it is neccessary and sufficient to promote a reporter gene, mark it as a promoter. If in doubt, consider marking it as an enhancer.


Example for sequence feature curation


Feature : "egl-1_temp_1.1"
Sequence VF23B12L
Mapping_target VF23B12L
Flanking_sequences cagctcaattattaaattttattgggtattgttta cataaaattctattgtcccagatttaggatacatcg
DNA_text CTCCTAACCGGGTGGTC
Description "This is a TRA-1 binding site that represses egl-1."
Remark "This is the TF_binding_site for TRA-1 which silences egl-1. N.B. a 'silencer' Feature has also been made at this location to aid expression and interaction curation [2013-07-23 gw3]"
Associated_with_gene WBGene00001170 // egl-1
Bound_by_product_of WBGene00006604 // tra-1
Transcription_factor WBTranscriptionFactor000029 // tra-1
Method  TF_binding_site
SO_term "SO:0000235" // TF_binding_site
Defined_by_paper WBPaper00003631
Public_name "TRA-1 binding site"

Feature : "egl-1_temp_1.2"
Sequence VF23B12L
Mapping_target VF23B12L
Flanking_sequences cagctcaattattaaattttattgggtattgttta cataaaattctattgtcccagatttaggatacatcg
DNA_text CTCCTAACCGGGTGGTC
Description "This is the silencer of egl-1, containing a single TF_binding_site bound by TRA-1."
Remark "Made this 'silencer' feature in addition to the TRA-1 TF_binding_site Feature to aid expression and interaction curation [2013-07-23 gw3]"
Associated_with_gene WBGene00001170 // egl-1
Method  silencer
SO_term "SO:0000625" // silencer
Defined_by_paper WBPaper00003631
Public_name "TRA-1 binding site silencer"

Link to Expression pattern

Link to Gene Regulation