Difference between revisions of "Mapped Transgenes"
From WormBaseWiki
Jump to navigationJump to searchLine 1: | Line 1: | ||
− | === WormBase Release WS195 === | + | === WormBase Release WS195 === |
− | 408 integrated transgenes with map information found | + | 408 integrated transgenes with map information found ([[Media:Mapped_transgenes.xls|download Excel file]]) |
− | {| | + | |
− | ! Transgene | + | {| width="" cellspacing="0" cellpadding="10" border="1" |
+ | |- | ||
+ | ! Transgene | ||
+ | ! Transgene_summary | ||
+ | ! Reporter | ||
+ | ! Strain | ||
+ | ! Map_position | ||
+ | ! Expression_pattern | ||
+ | ! Gene | ||
+ | ! Anatomy_term | ||
+ | ! Life_stage | ||
+ | ! Reference | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=WBPaper00005807Is1;class=Transgene WBPaper00005807Is1] | + | | [http://www.wormbase.org/db/get?name=WBPaper00005807Is1;class=Transgene WBPaper00005807Is1] |
+ | | [sur-5::gfp] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=CU217;class=Strain CU217] | ||
+ | | I | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=akIs7;class=Transgene akIs7] | + | | [http://www.wormbase.org/db/get?name=akIs7;class=Transgene akIs7] |
+ | | [nmr-1::gfp] | ||
+ | | GFP | ||
+ | | | ||
+ | | V | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=akIs9;class=Transgene akIs9] | + | | [http://www.wormbase.org/db/get?name=akIs9;class=Transgene akIs9] |
+ | | [glr-1::GLR-1(A/T)] | ||
+ | | | ||
+ | | | ||
+ | | X | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=arIs100;class=Transgene arIs100] | + | | [http://www.wormbase.org/db/get?name=arIs100;class=Transgene arIs100] |
+ | | [dpy-7::2Xnls-yfp] | ||
+ | | YFP | ||
+ | | | ||
+ | | II | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=arIs12;class=Transgene arIs12] | + | | [http://www.wormbase.org/db/get?name=arIs12;class=Transgene arIs12] |
+ | | [lin-12(intra)]. Expresses the intracellular domain of LIN-12 under the control of lin-12 promoter. Marked with rol-6(su1006). | ||
+ | | | ||
+ | | | ||
+ | | I | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=arIs37;class=Transgene arIs37] | + | | [http://www.wormbase.org/db/get?name=arIs37;class=Transgene arIs37] |
+ | | [pmyo-3::ssGFP] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=GS1912;class=Strain GS1912]<br>[http://www.wormbase.org/db/get?name=GS2477;class=Strain GS2477]<br>[http://www.wormbase.org/db/get?name=GS2478;class=Strain GS2478]<br>[http://www.wormbase.org/db/get?name=GS2479;class=Strain GS2479]<br>[http://www.wormbase.org/db/get?name=GS2484;class=Strain GS2484]<br>[http://www.wormbase.org/db/get?name=GS2495;class=Strain GS2495]<br>[http://www.wormbase.org/db/get?name=GS2526;class=Strain GS2526]<br>[http://www.wormbase.org/db/get?name=GS2527;class=Strain GS2527]<br>[http://www.wormbase.org/db/get?name=GS2532;class=Strain GS2532]<br>[http://www.wormbase.org/db/get?name=GS2555;class=Strain GS2555]<br>[http://www.wormbase.org/db/get?name=GS2643;class=Strain GS2643]<br>[http://www.wormbase.org/db/get?name=LW557;class=Strain LW557]<br>[http://www.wormbase.org/db/get?name=LW614;class=Strain LW614]<br>[http://www.wormbase.org/db/get?name=LW1288;class=Strain LW1288]<br>[http://www.wormbase.org/db/get?name=GS1919;class=Strain GS1919] | ||
+ | | I | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=arIs39;class=Transgene arIs39] | + | | [http://www.wormbase.org/db/get?name=arIs39;class=Transgene arIs39] |
+ | | [myo-3::secreted gfp] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=PD3011;class=Strain PD3011]<br>[http://www.wormbase.org/db/get?name=GS2077;class=Strain GS2077] | ||
+ | | X | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=arIs51;class=Transgene arIs51] | + | | [http://www.wormbase.org/db/get?name=arIs51;class=Transgene arIs51] |
+ | | [cdh-3::gfp] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=GS3754;class=Strain GS3754] | ||
+ | | IV | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=arIs99;class=Transgene arIs99] | + | | [http://www.wormbase.org/db/get?name=arIs99;class=Transgene arIs99] |
+ | | [dpy-7p::2Xnls::yfp] | ||
+ | | YFP | ||
+ | | | ||
+ | | X | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=axIs36;class=Transgene axIs36] | + | | [http://www.wormbase.org/db/get?name=axIs36;class=Transgene axIs36] |
+ | | [pes-10::gfp] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=JH103;class=Strain JH103] | ||
+ | | X | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=ayIs2;class=Transgene ayIs2] | + | | [http://www.wormbase.org/db/get?name=ayIs2;class=Transgene ayIs2] |
+ | | [egl-15::gfp] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=NH2447;class=Strain NH2447]<br>[http://www.wormbase.org/db/get?name=PD4285;class=Strain PD4285] | ||
+ | | IV | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=ayIs26;class=Transgene ayIs26] | + | | [http://www.wormbase.org/db/get?name=ayIs26;class=Transgene ayIs26] |
+ | | [Phsp16-2::let-756 (50 ng/ul); Pmyo-2::GFP (5 ng/ul)] | ||
+ | | GFP | ||
+ | | | ||
+ | | III | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=ayIs29;class=Transgene ayIs29] | + | | [http://www.wormbase.org/db/get?name=ayIs29;class=Transgene ayIs29] |
+ | | [egl-15(+) (5 ng/ul); Pmyo-2::GFP (5 ng/ul); pGEM5Z (70 ng/ul)] | ||
+ | | GFP | ||
+ | | | ||
+ | | IV | ||
+ | | [http://www.wormbase.org/db/get?name=Expr8096;class=Expr_pattern Expr8096] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00001184;class=Gene egl-15] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0005733;class=Anatomy_term hypodermis] | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00031854;class=Paper WBPaper00031854] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=ayIs4;class=Transgene ayIs4] | + | | [http://www.wormbase.org/db/get?name=ayIs4;class=Transgene ayIs4] |
+ | | [egl-17::gfp]. Integrated transgenic line of full length EGL-17 cDNA with GFP at its C term. | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=NH2246;class=Strain NH2246]<br>[http://www.wormbase.org/db/get?name=NH2466;class=Strain NH2466]<br>[http://www.wormbase.org/db/get?name=PS2580;class=Strain PS2580]<br>[http://www.wormbase.org/db/get?name=PS2674;class=Strain PS2674]<br>[http://www.wormbase.org/db/get?name=PS2987;class=Strain PS2987]<br>[http://www.wormbase.org/db/get?name=PS3082;class=Strain PS3082]<br>[http://www.wormbase.org/db/get?name=PS5106;class=Strain PS5106]<br>[http://www.wormbase.org/db/get?name=PS5423;class=Strain PS5423] | ||
+ | | I:-16 | ||
+ | | [http://www.wormbase.org/db/get?name=Expr630;class=Expr_pattern Expr630] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00001185;class=Gene egl-17] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0004812;class=Anatomy_term proct]<br>[http://www.wormbase.org/db/get?name=WBbt:0004402;class=Anatomy_term PChL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004810;class=Anatomy_term proct]<br>[http://www.wormbase.org/db/get?name=WBbt:0004391;class=Anatomy_term PChR]<br>[http://www.wormbase.org/db/get?name=WBbt:0005309;class=Anatomy_term spicule socket cell] | ||
+ | | [http://www.wormbase.org/db/get?name=L3%20larva;class=Life_stage L3 larva]<br>[http://www.wormbase.org/db/get?name=L4%20larva;class=Life_stage L4 larva]<br>[http://www.wormbase.org/db/get?name=adult;class=Life_stage adult] | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00003579;class=Paper WBPaper00003579] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=ayIs4;class=Transgene ayIs4] | + | | [http://www.wormbase.org/db/get?name=ayIs4;class=Transgene ayIs4] |
+ | | [egl-17::gfp]. Integrated transgenic line of full length EGL-17 cDNA with GFP at its C term. | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=NH2246;class=Strain NH2246]<br>[http://www.wormbase.org/db/get?name=NH2466;class=Strain NH2466]<br>[http://www.wormbase.org/db/get?name=PS2580;class=Strain PS2580]<br>[http://www.wormbase.org/db/get?name=PS2674;class=Strain PS2674]<br>[http://www.wormbase.org/db/get?name=PS2987;class=Strain PS2987]<br>[http://www.wormbase.org/db/get?name=PS3082;class=Strain PS3082]<br>[http://www.wormbase.org/db/get?name=PS5106;class=Strain PS5106]<br>[http://www.wormbase.org/db/get?name=PS5423;class=Strain PS5423] | ||
+ | | I:-16 | ||
+ | | [http://www.wormbase.org/db/get?name=Expr1434;class=Expr_pattern Expr1434] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00001185;class=Gene egl-17] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0007260;class=Anatomy_term P6.ppp]<br>[http://www.wormbase.org/db/get?name=WBbt:0006989;class=Anatomy_term P6.paa]<br>[http://www.wormbase.org/db/get?name=WBbt:0004147;class=Anatomy_term hyp7]<br>[http://www.wormbase.org/db/get?name=WBbt:0007265;class=Anatomy_term P7.ppa]<br>[http://www.wormbase.org/db/get?name=WBbt:0006764;class=Anatomy_term vulB2]<br>[http://www.wormbase.org/db/get?name=WBbt:0007256;class=Anatomy_term P5.ppa]<br>[http://www.wormbase.org/db/get?name=WBbt:0006984;class=Anatomy_term P7.pp]<br>[http://www.wormbase.org/db/get?name=WBbt:0006987;class=Anatomy_term P6.pa]<br>[http://www.wormbase.org/db/get?name=WBbt:0006767;class=Anatomy_term vulE]<br>[http://www.wormbase.org/db/get?name=WBbt:0004155;class=Anatomy_term hyp7]<br>[http://www.wormbase.org/db/get?name=WBbt:0006891;class=Anatomy_term P3.p]<br>[http://www.wormbase.org/db/get?name=WBbt:0007266;class=Anatomy_term P7.ppp]<br>[http://www.wormbase.org/db/get?name=WBbt:0006991;class=Anatomy_term P6.ppa]<br>[http://www.wormbase.org/db/get?name=WBbt:0006763;class=Anatomy_term vulB1]<br>[http://www.wormbase.org/db/get?name=WBbt:0007254;class=Anatomy_term P5.pap]<br>[http://www.wormbase.org/db/get?name=WBbt:0007253;class=Anatomy_term P5.paa]<br>[http://www.wormbase.org/db/get?name=WBbt:0006988;class=Anatomy_term P6.pp]<br>[http://www.wormbase.org/db/get?name=WBbt:0004153;class=Anatomy_term hyp7]<br>[http://www.wormbase.org/db/get?name=WBbt:0004145;class=Anatomy_term hyp7]<br>[http://www.wormbase.org/db/get?name=WBbt:0006990;class=Anatomy_term P6.pap]<br>[http://www.wormbase.org/db/get?name=WBbt:0006895;class=Anatomy_term P7.p]<br>[http://www.wormbase.org/db/get?name=WBbt:0005733;class=Anatomy_term hypodermis]<br>[http://www.wormbase.org/db/get?name=WBbt:0006892;class=Anatomy_term P4.p]<br>[http://www.wormbase.org/db/get?name=WBbt:0007255;class=Anatomy_term P5.pp]<br>[http://www.wormbase.org/db/get?name=WBbt:0005739;class=Anatomy_term head]<br>[http://www.wormbase.org/db/get?name=WBbt:0004467;class=Anatomy_term M4]<br>[http://www.wormbase.org/db/get?name=WBbt:0006983;class=Anatomy_term P7.pa]<br>[http://www.wormbase.org/db/get?name=WBbt:0006894;class=Anatomy_term P6.p]<br>[http://www.wormbase.org/db/get?name=WBbt:0006893;class=Anatomy_term P5.p]<br>[http://www.wormbase.org/db/get?name=WBbt:0006768;class=Anatomy_term vulF]<br>[http://www.wormbase.org/db/get?name=WBbt:0004448;class=Anatomy_term vulval cell]<br>[http://www.wormbase.org/db/get?name=WBbt:0006765;class=Anatomy_term vulC]<br>[http://www.wormbase.org/db/get?name=WBbt:0006896;class=Anatomy_term P8.p]<br>[http://www.wormbase.org/db/get?name=WBbt:0007252;class=Anatomy_term P5.pa]<br>[http://www.wormbase.org/db/get?name=WBbt:0004477;class=Anatomy_term vulval cell]<br>[http://www.wormbase.org/db/get?name=WBbt:0004151;class=Anatomy_term hyp7]<br>[http://www.wormbase.org/db/get?name=WBbt:0007264;class=Anatomy_term P7.pap]<br>[http://www.wormbase.org/db/get?name=WBbt:0006762;class=Anatomy_term vulA]<br>[http://www.wormbase.org/db/get?name=WBbt:0006766;class=Anatomy_term vulD]<br>[http://www.wormbase.org/db/get?name=WBbt:0004149;class=Anatomy_term hyp7] | ||
+ | | [http://www.wormbase.org/db/get?name=3-fold%20embryo;class=Life_stage 3-fold embryo]<br>[http://www.wormbase.org/db/get?name=fully-elongated%20embryo;class=Life_stage fully-elongated embryo]<br>[http://www.wormbase.org/db/get?name=postembryonic;class=Life_stage postembryonic] | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00003045;class=Paper WBPaper00003045] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=ayIs4;class=Transgene ayIs4] | + | | [http://www.wormbase.org/db/get?name=ayIs4;class=Transgene ayIs4] |
+ | | [egl-17::gfp]. Integrated transgenic line of full length EGL-17 cDNA with GFP at its C term. | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=NH2246;class=Strain NH2246]<br>[http://www.wormbase.org/db/get?name=NH2466;class=Strain NH2466]<br>[http://www.wormbase.org/db/get?name=PS2580;class=Strain PS2580]<br>[http://www.wormbase.org/db/get?name=PS2674;class=Strain PS2674]<br>[http://www.wormbase.org/db/get?name=PS2987;class=Strain PS2987]<br>[http://www.wormbase.org/db/get?name=PS3082;class=Strain PS3082]<br>[http://www.wormbase.org/db/get?name=PS5106;class=Strain PS5106]<br>[http://www.wormbase.org/db/get?name=PS5423;class=Strain PS5423] | ||
+ | | I:-16 | ||
+ | | [http://www.wormbase.org/db/get?name=Expr2354;class=Expr_pattern Expr2354] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00001185;class=Gene egl-17] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0006767;class=Anatomy_term vulE]<br>[http://www.wormbase.org/db/get?name=WBbt:0006768;class=Anatomy_term vulF]<br>[http://www.wormbase.org/db/get?name=WBbt:0006765;class=Anatomy_term vulC]<br>[http://www.wormbase.org/db/get?name=WBbt:0006766;class=Anatomy_term vulD] | ||
+ | | [http://www.wormbase.org/db/get?name=L3%20larva;class=Life_stage L3 larva]<br>[http://www.wormbase.org/db/get?name=L4%20larva;class=Life_stage L4 larva] | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00013312;class=Paper WBPaper00013312] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=ayIs6;class=Transgene ayIs6] | + | | [http://www.wormbase.org/db/get?name=ayIs6;class=Transgene ayIs6] |
+ | | [hlh-8::gfp] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=PD4666;class=Strain PD4666] | ||
+ | | X | ||
+ | | [http://www.wormbase.org/db/get?name=Expr8096;class=Expr_pattern Expr8096] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00001184;class=Gene egl-15] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0005733;class=Anatomy_term hypodermis] | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00031854;class=Paper WBPaper00031854] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=ayIs7;class=Transgene ayIs7] | + | | [http://www.wormbase.org/db/get?name=ayIs7;class=Transgene ayIs7] |
+ | | [hlh-8::gfp] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=PD4667;class=Strain PD4667]<br>[http://www.wormbase.org/db/get?name=RG174;class=Strain RG174] | ||
+ | | IV | ||
+ | | [http://www.wormbase.org/db/get?name=Marker68;class=Expr_pattern Marker68] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00001953;class=Gene hlh-8] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0004489;class=Anatomy_term M] | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00032077;class=Paper WBPaper00032077] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=ayIs9;class=Transgene ayIs9] | + | | [http://www.wormbase.org/db/get?name=ayIs9;class=Transgene ayIs9] |
+ | | [egl-17::gfp] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=NH646;class=Strain NH646] | ||
+ | | V | ||
+ | | [http://www.wormbase.org/db/get?name=Expr1814;class=Expr_pattern Expr1814] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00001185;class=Gene egl-17] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0006782;class=Anatomy_term dorsal uterine cell] | ||
+ | | [http://www.wormbase.org/db/get?name=L4%20larva;class=Life_stage L4 larva]<br>[http://www.wormbase.org/db/get?name=adult;class=Life_stage adult] | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00004362;class=Paper WBPaper00004362] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=bIs1;class=Transgene bIs1] | + | | [http://www.wormbase.org/db/get?name=bIs1;class=Transgene bIs1] |
+ | | [vit-2::gfp; rol-6(su1006)]. The plasmid V2B3 encodes a functional VIT-2(YP170B)::GFP fusion protein expressed under vit-2 promoter control. The plasmid was made by ligating a PCR product encoding vit-2 genomic sequences, including 1 kb of promoter and the complete gene lacking a stop codon, into the GFP plasmid pPD95.85, cut with XmaI and KpnI. The vit-2 gene was PCR amplified with primers V2F (TCCCCCCGGGTCCACGGACATTTCTGGGTCATTTG) and V2R (CGGGGTACCAGATAAGCGACGCAGGCGGTTGGGAC), containing engineered XmaI and KpnI sites, using cosmid DNA (C42D8) as a template. V2B3, at 50 ug/ml, was coinjected with rol-6(d) marker pRF4, at 100 ug/ml, into N2 to make transformed lines using standard methods. Four integrated lines (bIs1bIs4) were produced by standard methods. | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=DH1033;class=Strain DH1033]<br>[http://www.wormbase.org/db/get?name=DH1006;class=Strain DH1006] | ||
+ | | X | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=bcIs1;class=Transgene bcIs1] | + | | [http://www.wormbase.org/db/get?name=bcIs1;class=Transgene bcIs1] |
+ | | [egl-1::gfp] | ||
+ | | GFP | ||
+ | | | ||
+ | | III | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=bcIs24;class=Transgene bcIs24] | + | | [http://www.wormbase.org/db/get?name=bcIs24;class=Transgene bcIs24] |
+ | | [tph-1::gfp] | ||
+ | | GFP | ||
+ | | | ||
+ | | X | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=bcIs25;class=Transgene bcIs25] | + | | [http://www.wormbase.org/db/get?name=bcIs25;class=Transgene bcIs25] |
+ | | [tph-1::gfp] | ||
+ | | GFP | ||
+ | | | ||
+ | | IV | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=bcIs30;class=Transgene bcIs30] | + | | [http://www.wormbase.org/db/get?name=bcIs30;class=Transgene bcIs30] |
+ | | [tph-1::gfp] | ||
+ | | GFP | ||
+ | | | ||
+ | | X | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=bcIs37;class=Transgene bcIs37] | + | | [http://www.wormbase.org/db/get?name=bcIs37;class=Transgene bcIs37] |
+ | | [egl-1::his24-gfp] | ||
+ | | GFP | ||
+ | | | ||
+ | | V | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=bcIs39;class=Transgene bcIs39] | + | | [http://www.wormbase.org/db/get?name=bcIs39;class=Transgene bcIs39] |
+ | | [lim-7::ced-1-gfp] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=MD701;class=Strain MD701] | ||
+ | | V | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=bnIs1;class=Transgene bnIs1] | + | | [http://www.wormbase.org/db/get?name=bnIs1;class=Transgene bnIs1] |
+ | | [pie-1::gfp-pgl-1, unc-119(+)]. Constructed by amplification of a 2.2 kb segment of pgl-1 cDNA with the primers 5'-GGACTAGTATGGAGGCTAACAAGCG-3' and 5'-CCACTAGTTTAGAAACCTCCGCGTCC-3', digestion of the PCR product and the plasmid pAZ132 with SpeI, ligation of the pgl-1 product and the SpeI fragment of pAZ132 bearing unc-119(+) and pie-1::gfp sequences, and bombardment of the ligated DNA into unc-119(ed3) worms. | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=SS747;class=Strain SS747]<br>[http://www.wormbase.org/db/get?name=SS629;class=Strain SS629] | ||
+ | | I | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=bpIs56;class=Transgene bpIs56] | + | | [http://www.wormbase.org/db/get?name=bpIs56;class=Transgene bpIs56] |
+ | | [alg-1::dsRed] | ||
+ | | DsRed | ||
+ | | | ||
+ | | II | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=bxIs13;class=Transgene bxIs13] | + | | [http://www.wormbase.org/db/get?name=bxIs13;class=Transgene bxIs13] |
+ | | [egl-5::gfp, lin-15] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=EM599;class=Strain EM599]<br>[http://www.wormbase.org/db/get?name=HZ107;class=Strain HZ107]<br>[http://www.wormbase.org/db/get?name=HZ113;class=Strain HZ113] | ||
+ | | X | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=bxIs14;class=Transgene bxIs14] | + | | [http://www.wormbase.org/db/get?name=bxIs14;class=Transgene bxIs14] |
+ | | [pkd-2::gfp, pha-1] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=EM886;class=Strain EM886]<br>[http://www.wormbase.org/db/get?name=EM902;class=Strain EM902]<br>[http://www.wormbase.org/db/get?name=EM905;class=Strain EM905]<br>[http://www.wormbase.org/db/get?name=EM907;class=Strain EM907]<br>[http://www.wormbase.org/db/get?name=EM908;class=Strain EM908]<br>[http://www.wormbase.org/db/get?name=EM909;class=Strain EM909]<br>[http://www.wormbase.org/db/get?name=EM911;class=Strain EM911] | ||
+ | | V | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=bxIs16;class=Transgene bxIs16] | + | | [http://www.wormbase.org/db/get?name=bxIs16;class=Transgene bxIs16] |
+ | | [tph-1::gfp (EM#310), cat-2::yfp (EM#303), pBX-1] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=HZ66;class=Strain HZ66]<br>[http://www.wormbase.org/db/get?name=HZ67;class=Strain HZ67] | ||
+ | | V | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=bzIs3;class=Transgene bzIs3] | + | | [http://www.wormbase.org/db/get?name=bzIs3;class=Transgene bzIs3] |
+ | | [mec-4::lacZ]. Contains ~10 copies of mec-4(u231) allele and several copies of mec-4::lacZ fusion TU#44. | ||
+ | | LacZ | ||
+ | | [http://www.wormbase.org/db/get?name=ZB7;class=Strain ZB7] | ||
+ | | X | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=bzIs67;class=Transgene bzIs67] | + | | [http://www.wormbase.org/db/get?name=bzIs67;class=Transgene bzIs67] |
+ | | [mec-10::mec-10(d)-GFP pRF4] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=ZB2356;class=Strain ZB2356] | ||
+ | | X | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=bzIs7;class=Transgene bzIs7] | + | | [http://www.wormbase.org/db/get?name=bzIs7;class=Transgene bzIs7] |
+ | | [mec-4::gfp] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=ZB171;class=Strain ZB171] | ||
+ | | IV | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=bzIs75;class=Transgene bzIs75] | + | | [http://www.wormbase.org/db/get?name=bzIs75;class=Transgene bzIs75] |
+ | | [mec-4::mec-10(d)-GFP unc-119(+)] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=ZB2374;class=Strain ZB2374] | ||
+ | | IV | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=ccIs4251;class=Transgene ccIs4251] | + | | [http://www.wormbase.org/db/get?name=ccIs4251;class=Transgene ccIs4251] |
+ | | [myo-3::Ngfp-lacZ; myo-3::Mtgfp] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=CB5600;class=Strain CB5600]<br>[http://www.wormbase.org/db/get?name=HC75;class=Strain HC75]<br>[http://www.wormbase.org/db/get?name=HC114;class=Strain HC114]<br>[http://www.wormbase.org/db/get?name=HC271;class=Strain HC271]<br>[http://www.wormbase.org/db/get?name=PD4251;class=Strain PD4251]<br>[http://www.wormbase.org/db/get?name=PD6249;class=Strain PD6249] | ||
+ | | I:4 | ||
+ | | [http://www.wormbase.org/db/get?name=Marker38;class=Expr_pattern Marker38] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00003515;class=Gene myo-3] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0003675;class=Anatomy_term muscle cell] | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00031556;class=Paper WBPaper00031556] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=ccIs4438;class=Transgene ccIs4438] | + | | [http://www.wormbase.org/db/get?name=ccIs4438;class=Transgene ccIs4438] |
+ | | [hlh-8::gfp] | ||
+ | | GFP | ||
+ | | | ||
+ | | IV | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=ccIs4439;class=Transgene ccIs4439] | + | | [http://www.wormbase.org/db/get?name=ccIs4439;class=Transgene ccIs4439] |
+ | | [intrinsic CC::gfp] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=PD4439;class=Strain PD4439] | ||
+ | | III | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=ccIs4443;class=Transgene ccIs4443] | + | | [http://www.wormbase.org/db/get?name=ccIs4443;class=Transgene ccIs4443] |
+ | | [arg-1::gfp] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=PD4443;class=Strain PD4443] | ||
+ | | IV | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=ccIs4444;class=Transgene ccIs4444] | + | | [http://www.wormbase.org/db/get?name=ccIs4444;class=Transgene ccIs4444] |
+ | | [arg-1::gfp; dpy-20(+)] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=PD4444;class=Strain PD4444] | ||
+ | | II | ||
+ | | [http://www.wormbase.org/db/get?name=Expr4734;class=Expr_pattern Expr4734] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00000185;class=Gene arg-1] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0005821;class=Anatomy_term vulval muscle]<br>[http://www.wormbase.org/db/get?name=WBbt:0004292;class=Anatomy_term anal depressor muscle]<br>[http://www.wormbase.org/db/get?name=WBbt:0004697;class=Anatomy_term hmc]<br>[http://www.wormbase.org/db/get?name=WBbt:0005796;class=Anatomy_term intestinal muscle]<br>[http://www.wormbase.org/db/get?name=WBbt:0005798;class=Anatomy_term anal sphincter muscle] | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00029191;class=Paper WBPaper00029191] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=ccIs4595;class=Transgene ccIs4595] | + | | [http://www.wormbase.org/db/get?name=ccIs4595;class=Transgene ccIs4595] |
+ | | [ceh-24::gfp] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=PD4595;class=Strain PD4595] | ||
+ | | V | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=ccIs4636;class=Transgene ccIs4636] | + | | [http://www.wormbase.org/db/get?name=ccIs4636;class=Transgene ccIs4636] |
+ | | [hlh-8::lacZ] | ||
+ | | LacZ | ||
+ | | [http://www.wormbase.org/db/get?name=PD4636;class=Strain PD4636] | ||
+ | | V | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=ccIs4655;class=Transgene ccIs4655] | + | | [http://www.wormbase.org/db/get?name=ccIs4655;class=Transgene ccIs4655] |
+ | | [Nde-box::gfp] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=PD4655;class=Strain PD4655] | ||
+ | | II | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=ccIs4656;class=Transgene ccIs4656] | + | | [http://www.wormbase.org/db/get?name=ccIs4656;class=Transgene ccIs4656] |
+ | | [NdE-box::gfp] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=PD4656;class=Strain PD4656] | ||
+ | | IV | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=ccIs4810;class=Transgene ccIs4810] | + | | [http://www.wormbase.org/db/get?name=ccIs4810;class=Transgene ccIs4810] |
+ | | [lmn-1::gfp]. A fusion of GFP to the C-terminus of Ce-lamin. | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=YG1021;class=Strain YG1021]<br>[http://www.wormbase.org/db/get?name=LW0697;class=Strain LW0697] | ||
+ | | X | ||
+ | | [http://www.wormbase.org/db/get?name=Expr956;class=Expr_pattern Expr956] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00003052;class=Gene lmn-1] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0004017;class=Anatomy_term Cell] | ||
+ | | [http://www.wormbase.org/db/get?name=all%20stages;class=Life_stage all stages] | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00004416;class=Paper WBPaper00004416] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=ccIs4810;class=Transgene ccIs4810] | + | | [http://www.wormbase.org/db/get?name=ccIs4810;class=Transgene ccIs4810] |
+ | | [lmn-1::gfp]. A fusion of GFP to the C-terminus of Ce-lamin. | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=YG1021;class=Strain YG1021]<br>[http://www.wormbase.org/db/get?name=LW0697;class=Strain LW0697] | ||
+ | | X | ||
+ | | [http://www.wormbase.org/db/get?name=Marker9;class=Expr_pattern Marker9] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00003052;class=Gene lmn-1] | ||
+ | | | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00026936;class=Paper WBPaper00026936] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=ccIs4811;class=Transgene ccIs4811] | + | | [http://www.wormbase.org/db/get?name=ccIs4811;class=Transgene ccIs4811] |
+ | | [lmn-1::lmn-1-gfp-lmn-1 3UTR; pMH86(dpy-20(+)] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=LW0698;class=Strain LW0698] | ||
+ | | X | ||
+ | | [http://www.wormbase.org/db/get?name=Marker9;class=Expr_pattern Marker9] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00003052;class=Gene lmn-1] | ||
+ | | | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00026936;class=Paper WBPaper00026936] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=ccIs4812;class=Transgene ccIs4812] | + | | [http://www.wormbase.org/db/get?name=ccIs4812;class=Transgene ccIs4812] |
+ | | [lmn-1::lmn-1-gfp-lmn-1 3UTR; pMH86(dpy-20(+)] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=LW0700;class=Strain LW0700] | ||
+ | | X | ||
+ | | [http://www.wormbase.org/db/get?name=Marker9;class=Expr_pattern Marker9] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00003052;class=Gene lmn-1] | ||
+ | | | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00026936;class=Paper WBPaper00026936] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=ccIs55;class=Transgene ccIs55] | + | | [http://www.wormbase.org/db/get?name=ccIs55;class=Transgene ccIs55] |
+ | | [sup-7(st5)unc-54::LacZ] | ||
+ | | LacZ | ||
+ | | [http://www.wormbase.org/db/get?name=PD55;class=Strain PD55]<br>[http://www.wormbase.org/db/get?name=PJ1002;class=Strain PJ1002]<br>[http://www.wormbase.org/db/get?name=PJ1015;class=Strain PJ1015]<br>[http://www.wormbase.org/db/get?name=PJ1034;class=Strain PJ1034]<br>[http://www.wormbase.org/db/get?name=PJ1036;class=Strain PJ1036]<br>[http://www.wormbase.org/db/get?name=PJ1039;class=Strain PJ1039]<br>[http://www.wormbase.org/db/get?name=PJ1044;class=Strain PJ1044]<br>[http://www.wormbase.org/db/get?name=PJ1046;class=Strain PJ1046]<br>[http://www.wormbase.org/db/get?name=PJ1062;class=Strain PJ1062]<br>[http://www.wormbase.org/db/get?name=PJ1063;class=Strain PJ1063]<br>[http://www.wormbase.org/db/get?name=PJ1065;class=Strain PJ1065]<br>[http://www.wormbase.org/db/get?name=PJ1069;class=Strain PJ1069]<br>[http://www.wormbase.org/db/get?name=PJ1070;class=Strain PJ1070]<br>[http://www.wormbase.org/db/get?name=PJ1076;class=Strain PJ1076]<br>[http://www.wormbase.org/db/get?name=PJ1078;class=Strain PJ1078]<br>[http://www.wormbase.org/db/get?name=PJ1080;class=Strain PJ1080]<br>[http://www.wormbase.org/db/get?name=PJ1085;class=Strain PJ1085]<br>[http://www.wormbase.org/db/get?name=PJ1092;class=Strain PJ1092]<br>[http://www.wormbase.org/db/get?name=PJ1093;class=Strain PJ1093]<br>[http://www.wormbase.org/db/get?name=PJ1099;class=Strain PJ1099]<br>[http://www.wormbase.org/db/get?name=PJ1100;class=Strain PJ1100]<br>[http://www.wormbase.org/db/get?name=PJ1105;class=Strain PJ1105]<br>[http://www.wormbase.org/db/get?name=PJ1107;class=Strain PJ1107]<br>[http://www.wormbase.org/db/get?name=PJ1109;class=Strain PJ1109]<br>[http://www.wormbase.org/db/get?name=PJ1110;class=Strain PJ1110]<br>[http://www.wormbase.org/db/get?name=PJ1114;class=Strain PJ1114]<br>[http://www.wormbase.org/db/get?name=PJ1115;class=Strain PJ1115]<br>[http://www.wormbase.org/db/get?name=PJ1121;class=Strain PJ1121]<br>[http://www.wormbase.org/db/get?name=PJ1124;class=Strain PJ1124]<br>[http://www.wormbase.org/db/get?name=PJ1126;class=Strain PJ1126]<br>[http://www.wormbase.org/db/get?name=PJ1132;class=Strain PJ1132]<br>[http://www.wormbase.org/db/get?name=PJ1134;class=Strain PJ1134]<br>[http://www.wormbase.org/db/get?name=PJ1145;class=Strain PJ1145]<br>[http://www.wormbase.org/db/get?name=PJ1146;class=Strain PJ1146]<br>[http://www.wormbase.org/db/get?name=PJ1153;class=Strain PJ1153]<br>[http://www.wormbase.org/db/get?name=PJ1154;class=Strain PJ1154]<br>[http://www.wormbase.org/db/get?name=PJ1155;class=Strain PJ1155]<br>[http://www.wormbase.org/db/get?name=PJ1156;class=Strain PJ1156]<br>[http://www.wormbase.org/db/get?name=PJ1158;class=Strain PJ1158]<br>[http://www.wormbase.org/db/get?name=PJ1162;class=Strain PJ1162]<br>[http://www.wormbase.org/db/get?name=PJ1166;class=Strain PJ1166] | ||
+ | | V | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=ccIs7963;class=Transgene ccIs7963] | + | | [http://www.wormbase.org/db/get?name=ccIs7963;class=Transgene ccIs7963] |
+ | | [hlh-1::gfp] | ||
+ | | GFP | ||
+ | | | ||
+ | | V | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=ccIs9753;class=Transgene ccIs9753] || | + | | [http://www.wormbase.org/db/get?name=ccIs9753;class=Transgene ccIs9753] |
+ | | | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=PD9753;class=Strain PD9753] | ||
+ | | I:27.5 | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=cdIs5;class=Transgene cdIs5] | + | | [http://www.wormbase.org/db/get?name=cdIs5;class=Transgene cdIs5] |
+ | | [myo-3::DsRed2] | ||
+ | | DsRed2 | ||
+ | | | ||
+ | | I | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=cgc3903Is1;class=Transgene cgc3903Is1] | + | | [http://www.wormbase.org/db/get?name=cgc3903Is1;class=Transgene cgc3903Is1] |
+ | | [tph-1::gfp]. A DNA fragment encompassing the 3.1 kb tph-1 5' regulatory sequence and introns and exons to the beginning of exon 4, was PCR amplied using primers containing restriction sites, ligated to the GFP cassette pPD95.75. | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=GR1333;class=Strain GR1333] | ||
+ | | V | ||
+ | | [http://www.wormbase.org/db/get?name=Expr959;class=Expr_pattern Expr959] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00006600;class=Gene tph-1] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0004757;class=Anatomy_term HSNR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003999;class=Anatomy_term ADFR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004446;class=Anatomy_term NSMR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003983;class=Anatomy_term AIML]<br>[http://www.wormbase.org/db/get?name=WBbt:0004457;class=Anatomy_term NSML]<br>[http://www.wormbase.org/db/get?name=WBbt:0003969;class=Anatomy_term AIMR]<br>[http://www.wormbase.org/db/get?name=WBbt:0005310;class=Anatomy_term CP neuron]<br>[http://www.wormbase.org/db/get?name=WBbt:0003928;class=Anatomy_term RIH]<br>[http://www.wormbase.org/db/get?name=WBbt:0004003;class=Anatomy_term ADFL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004758;class=Anatomy_term HSNL] | ||
+ | | [http://www.wormbase.org/db/get?name=L1%20larva;class=Life_stage L1 larva]<br>[http://www.wormbase.org/db/get?name=adult;class=Life_stage adult] | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00003903;class=Paper WBPaper00003903] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=cgc5080Is2;class=Transgene cgc5080Is2] | + | | [http://www.wormbase.org/db/get?name=cgc5080Is2;class=Transgene cgc5080Is2] |
+ | | [rgs-2::gfp] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=LX354;class=Strain LX354] | ||
+ | | IV | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=cgc5924Is1;class=Transgene cgc5924Is1] | + | | [http://www.wormbase.org/db/get?name=cgc5924Is1;class=Transgene cgc5924Is1] |
+ | | [tph-1::gfp; rol-6(su1006)] | ||
+ | | GFP | ||
+ | | | ||
+ | | V | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=cgc6572Is1;class=Transgene cgc6572Is1] | + | | [http://www.wormbase.org/db/get?name=cgc6572Is1;class=Transgene cgc6572Is1] |
+ | | [pie-1::gfp-spd-2] translational fusion. | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=TH42;class=Strain TH42] | ||
+ | | II | ||
+ | | [http://www.wormbase.org/db/get?name=Expr2995;class=Expr_pattern Expr2995] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00004953;class=Gene spd-2] | ||
+ | | | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00013494;class=Paper WBPaper00013494] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=cgc6998Is1;class=Transgene cgc6998Is1] | + | | [http://www.wormbase.org/db/get?name=cgc6998Is1;class=Transgene cgc6998Is1] |
+ | | [kin-29::gfp] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=PY3018;class=Strain PY3018] | ||
+ | | IV | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=cgc7137Is1;class=Transgene cgc7137Is1] | + | | [http://www.wormbase.org/db/get?name=cgc7137Is1;class=Transgene cgc7137Is1] |
+ | | [elt-2::gfp-LacZ] | ||
+ | | GFP | ||
+ | | | ||
+ | | X | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=chIs1200;class=Transgene chIs1200] | + | | [http://www.wormbase.org/db/get?name=chIs1200;class=Transgene chIs1200] |
+ | | [ceh-26::gfp] translational fusion. | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=TB1225;class=Strain TB1225] | ||
+ | | III | ||
+ | | [http://www.wormbase.org/db/get?name=Expr2696;class=Expr_pattern Expr2696] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00000448;class=Gene ceh-26] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0004761;class=Anatomy_term HOB] | ||
+ | | [http://www.wormbase.org/db/get?name=L4%20larva;class=Life_stage L4 larva]<br>[http://www.wormbase.org/db/get?name=adult%20male;class=Life_stage adult male] | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00006247;class=Paper WBPaper00006247] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=cmIs6;class=Transgene cmIs6] | + | | [http://www.wormbase.org/db/get?name=cmIs6;class=Transgene cmIs6] |
+ | | [mbk-1::gfp] translational fusion. The mbk-1 genomic locus, including 7 kb of 5' noncoding sequence and all exons and introns, was amplified by Expand long-template PCR. The PCR product was cloned in frame with gfp in the promoterless vector pPD95.75, generating pBR104. | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=EK224;class=Strain EK224] | ||
+ | | I | ||
+ | | [http://www.wormbase.org/db/get?name=Expr2387;class=Expr_pattern Expr2387] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00003149;class=Gene mbk-1] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0004017;class=Anatomy_term Cell] | ||
+ | | [http://www.wormbase.org/db/get?name=gastrulating%20embryo;class=Life_stage gastrulating embryo]<br>[http://www.wormbase.org/db/get?name=enclosing%20embryo;class=Life_stage enclosing embryo]<br>[http://www.wormbase.org/db/get?name=elongating%20embryo;class=Life_stage elongating embryo]<br>[http://www.wormbase.org/db/get?name=fully-elongated%20embryo;class=Life_stage fully-elongated embryo]<br>[http://www.wormbase.org/db/get?name=L1%20larva;class=Life_stage L1 larva]<br>[http://www.wormbase.org/db/get?name=L2%20larva;class=Life_stage L2 larva]<br>[http://www.wormbase.org/db/get?name=L3%20larva;class=Life_stage L3 larva]<br>[http://www.wormbase.org/db/get?name=L4%20larva;class=Life_stage L4 larva]<br>[http://www.wormbase.org/db/get?name=adult;class=Life_stage adult] | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00005756;class=Paper WBPaper00005756] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=ctIs1;class=Transgene ctIs1] | + | | [http://www.wormbase.org/db/get?name=ctIs1;class=Transgene ctIs1] |
+ | | [her-1::lacZ]. The construct is also known as P2::lacZ. P2 refers to the 3.4 kb of DNA upstream of her-1 exon-3. | ||
+ | | LacZ | ||
+ | | | ||
+ | | I | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=ctIs32;class=Transgene ctIs32] | + | | [http://www.wormbase.org/db/get?name=ctIs32;class=Transgene ctIs32] |
+ | | [her-1::gfp]. The construct is also known as P2::gfp. P2 refers to the 3.4 kb of DNA upstream of her-1 exon-3. | ||
+ | | GFP | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=ctIs40;class=Transgene ctIs40] | + | | [http://www.wormbase.org/db/get?name=ctIs40;class=Transgene ctIs40] |
+ | | [ZC421(+); sur-5::gfp]. Overexprss cosmid ZC421 which contains gene dbl-1. sur-5::gfp is used as injection marker. | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=BW1940;class=Strain BW1940] | ||
+ | | X | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=ctIs43;class=Transgene ctIs43] | + | | [http://www.wormbase.org/db/get?name=ctIs43;class=Transgene ctIs43] |
+ | | [unc-119(+); dbl-1::gfp+NLS; dbl-1::gfp-NLS] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=BW1935;class=Strain BW1935]<br>[http://www.wormbase.org/db/get?name=BW1946;class=Strain BW1946] | ||
+ | | V | ||
+ | | [http://www.wormbase.org/db/get?name=Expr626;class=Expr_pattern Expr626] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00000936;class=Gene dbl-1] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0004625;class=Anatomy_term VB10]<br>[http://www.wormbase.org/db/get?name=WBbt:0004488;class=Anatomy_term M1]<br>[http://www.wormbase.org/db/get?name=WBbt:0004465;class=Anatomy_term M5]<br>[http://www.wormbase.org/db/get?name=WBbt:0004631;class=Anatomy_term VB7]<br>[http://www.wormbase.org/db/get?name=WBbt:0004949;class=Anatomy_term CANL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004653;class=Anatomy_term VA8]<br>[http://www.wormbase.org/db/get?name=WBbt:0004842;class=Anatomy_term DB5]<br>[http://www.wormbase.org/db/get?name=WBbt:0004645;class=Anatomy_term VA12]<br>[http://www.wormbase.org/db/get?name=WBbt:0004627;class=Anatomy_term VB9]<br>[http://www.wormbase.org/db/get?name=WBbt:0004863;class=Anatomy_term DA5]<br>[http://www.wormbase.org/db/get?name=WBbt:0004629;class=Anatomy_term VB8]<br>[http://www.wormbase.org/db/get?name=WBbt:0003845;class=Anatomy_term AVKL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004639;class=Anatomy_term VB3]<br>[http://www.wormbase.org/db/get?name=WBbt:0004862;class=Anatomy_term VA6]<br>[http://www.wormbase.org/db/get?name=WBbt:0004954;class=Anatomy_term SPso3L]<br>[http://www.wormbase.org/db/get?name=WBbt:0004840;class=Anatomy_term DB7]<br>[http://www.wormbase.org/db/get?name=WBbt:0004823;class=Anatomy_term DVA]<br>[http://www.wormbase.org/db/get?name=WBbt:0004841;class=Anatomy_term DB6]<br>[http://www.wormbase.org/db/get?name=WBbt:0004955;class=Anatomy_term SPso2R]<br>[http://www.wormbase.org/db/get?name=WBbt:0004843;class=Anatomy_term DB4]<br>[http://www.wormbase.org/db/get?name=WBbt:0004740;class=Anatomy_term I5]<br>[http://www.wormbase.org/db/get?name=WBbt:0004637;class=Anatomy_term VB5]<br>[http://www.wormbase.org/db/get?name=WBbt:0004866;class=Anatomy_term VA4]<br>[http://www.wormbase.org/db/get?name=WBbt:0004329;class=Anatomy_term pm2R]<br>[http://www.wormbase.org/db/get?name=WBbt:0004623;class=Anatomy_term VB11]<br>[http://www.wormbase.org/db/get?name=WBbt:0004649;class=Anatomy_term VA10]<br>[http://www.wormbase.org/db/get?name=WBbt:0004633;class=Anatomy_term VB6]<br>[http://www.wormbase.org/db/get?name=WBbt:0004860;class=Anatomy_term VA7]<br>[http://www.wormbase.org/db/get?name=WBbt:0004647;class=Anatomy_term VA11]<br>[http://www.wormbase.org/db/get?name=WBbt:0004952;class=Anatomy_term SPso3R]<br>[http://www.wormbase.org/db/get?name=WBbt:0004845;class=Anatomy_term DB2]<br>[http://www.wormbase.org/db/get?name=WBbt:0004861;class=Anatomy_term DA6]<br>[http://www.wormbase.org/db/get?name=WBbt:0004467;class=Anatomy_term M4]<br>[http://www.wormbase.org/db/get?name=WBbt:0004956;class=Anatomy_term SPso2L]<br>[http://www.wormbase.org/db/get?name=WBbt:0004859;class=Anatomy_term DA7]<br>[http://www.wormbase.org/db/get?name=WBbt:0004947;class=Anatomy_term CANR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004950;class=Anatomy_term SPso4L]<br>[http://www.wormbase.org/db/get?name=WBbt:0004957;class=Anatomy_term SPso1R]<br>[http://www.wormbase.org/db/get?name=WBbt:0004864;class=Anatomy_term VA5]<br>[http://www.wormbase.org/db/get?name=WBbt:0003844;class=Anatomy_term AVKR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004643;class=Anatomy_term VB1]<br>[http://www.wormbase.org/db/get?name=WBbt:0004870;class=Anatomy_term VA2]<br>[http://www.wormbase.org/db/get?name=WBbt:0004330;class=Anatomy_term pm2L]<br>[http://www.wormbase.org/db/get?name=WBbt:0005439;class=Anatomy_term pharyngeal neuron]<br>[http://www.wormbase.org/db/get?name=WBbt:0005829;class=Anatomy_term ventral nerve cord]<br>[http://www.wormbase.org/db/get?name=WBbt:0004846;class=Anatomy_term DB1]<br>[http://www.wormbase.org/db/get?name=WBbt:0004865;class=Anatomy_term DA4]<br>[http://www.wormbase.org/db/get?name=WBbt:0004641;class=Anatomy_term VB2]<br>[http://www.wormbase.org/db/get?name=WBbt:0006750;class=Anatomy_term dorsal nerve cord]<br>[http://www.wormbase.org/db/get?name=WBbt:0004844;class=Anatomy_term DB3]<br>[http://www.wormbase.org/db/get?name=WBbt:0004958;class=Anatomy_term SPso1L]<br>[http://www.wormbase.org/db/get?name=WBbt:0004651;class=Anatomy_term VA9]<br>[http://www.wormbase.org/db/get?name=WBbt:0004867;class=Anatomy_term DA3]<br>[http://www.wormbase.org/db/get?name=WBbt:0004948;class=Anatomy_term SPso4R]<br>[http://www.wormbase.org/db/get?name=WBbt:0004638;class=Anatomy_term VB4]<br>[http://www.wormbase.org/db/get?name=WBbt:0004385;class=Anatomy_term PDB] | ||
+ | | [http://www.wormbase.org/db/get?name=embryo;class=Life_stage embryo]<br>[http://www.wormbase.org/db/get?name=L1%20larva;class=Life_stage L1 larva]<br>[http://www.wormbase.org/db/get?name=L2%20larva;class=Life_stage L2 larva]<br>[http://www.wormbase.org/db/get?name=L3%20larva;class=Life_stage L3 larva]<br>[http://www.wormbase.org/db/get?name=L4%20larva;class=Life_stage L4 larva]<br>[http://www.wormbase.org/db/get?name=adult;class=Life_stage adult] | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00003401;class=Paper WBPaper00003401] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=cuIs2;class=Transgene cuIs2] | + | | [http://www.wormbase.org/db/get?name=cuIs2;class=Transgene cuIs2] |
+ | | [myo-2 C183::gfp]. Integrated expression line for myo-2 enhancer C subelement C183::gfp. | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=OK39;class=Strain OK39]<br>[http://www.wormbase.org/db/get?name=OK66;class=Strain OK66]<br>[http://www.wormbase.org/db/get?name=OK68;class=Strain OK68]<br>[http://www.wormbase.org/db/get?name=OK0039;class=Strain OK0039] | ||
+ | | IV | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=cuIs22;class=Transgene cuIs22] | + | | [http://www.wormbase.org/db/get?name=cuIs22;class=Transgene cuIs22] |
+ | | [ceh-22::gfp] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=OK0507;class=Strain OK0507] | ||
+ | | III | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=cuIs5;class=Transgene cuIs5] | + | | [http://www.wormbase.org/db/get?name=cuIs5;class=Transgene cuIs5] |
+ | | [myo-2 C183::gfp]. Integrated expression line for myo-2 enhancer C subelement C183::gfp. | ||
+ | | GFP | ||
+ | | | ||
+ | | I | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=dhIs26;class=Transgene dhIs26] | + | | [http://www.wormbase.org/db/get?name=dhIs26;class=Transgene dhIs26] |
+ | | [daf-12A::gfp; lin15(+)] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=AA120;class=Strain AA120] | ||
+ | | I | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=dtIs372;class=Transgene dtIs372] | + | | [http://www.wormbase.org/db/get?name=dtIs372;class=Transgene dtIs372] |
+ | | [his-24::his-24-gfp] | ||
+ | | GFP | ||
+ | | | ||
+ | | X | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=dvIs19;class=Transgene dvIs19] | + | | [http://www.wormbase.org/db/get?name=dvIs19;class=Transgene dvIs19] |
+ | | [K08F4.7(727bp):GFP-NLS] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=CL2166;class=Strain CL2166] | ||
+ | | III | ||
+ | | [http://www.wormbase.org/db/get?name=Expr8083;class=Expr_pattern Expr8083] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00001752;class=Gene gst-4] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0005813;class=Anatomy_term body wall musculature] | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00031223;class=Paper WBPaper00031223] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=eIs24;class=Transgene eIs24] | + | | [http://www.wormbase.org/db/get?name=eIs24;class=Transgene eIs24] |
+ | | [vab-7::lacZ] | ||
+ | | LacZ | ||
+ | | | ||
+ | | II | ||
+ | | [http://www.wormbase.org/db/get?name=Expr93;class=Expr_pattern Expr93] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00006873;class=Gene vab-7] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0006098;class=Anatomy_term Capp]<br>[http://www.wormbase.org/db/get?name=WBbt:0006268;class=Anatomy_term Cppp]<br>[http://www.wormbase.org/db/get?name=WBbt:0005921;class=Anatomy_term Caap]<br>[http://www.wormbase.org/db/get?name=WBbt:0006628;class=Anatomy_term Cpap] | ||
+ | | [http://www.wormbase.org/db/get?name=embryo;class=Life_stage embryo]<br>[http://www.wormbase.org/db/get?name=L1%20larva;class=Life_stage L1 larva] | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00002462;class=Paper WBPaper00002462] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=eIs25;class=Transgene eIs25] | + | | [http://www.wormbase.org/db/get?name=eIs25;class=Transgene eIs25] |
+ | | [fox-1(gf); rol-6(su1006)]. Contains extrachromosomal copies of R04B3, a cosmid containing fox-1 genomic region. | ||
+ | | | ||
+ | | | ||
+ | | V | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=eIs26;class=Transgene eIs26] | + | | [http://www.wormbase.org/db/get?name=eIs26;class=Transgene eIs26] |
+ | | [fox-1(gf); rol-6(su1006)]. Contains extrachromosomal copies of R04B3, a cosmid containing fox-1 genomic region. | ||
+ | | | ||
+ | | | ||
+ | | IV | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=eIs27;class=Transgene eIs27] | + | | [http://www.wormbase.org/db/get?name=eIs27;class=Transgene eIs27] |
+ | | [fox-1(gf); rol-6(su1006)]. Contains extrachromosomal copies of R04B3, a cosmid containing fox-1 genomic region. | ||
+ | | | ||
+ | | | ||
+ | | V | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=eIs[unc-31::lacZ];class=Transgene eIs[unc-31::lacZ]] | + | | [http://www.wormbase.org/db/get?name=eIs [unc-31::lacZ];class=Transgene eIs[unc-31::lacZ]] |
+ | | [unc-31::lacZ], in-frame fusion, consists of 15 kb 5' upstream sequence and most of the coding regions of unc-31. | ||
+ | | LacZ | ||
+ | | | ||
+ | | V | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=edIs6;class=Transgene edIs6] | + | | [http://www.wormbase.org/db/get?name=edIs6;class=Transgene edIs6] |
+ | | [unc-119::gfp] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=DP132;class=Strain DP132] | ||
+ | | IV | ||
+ | | [http://www.wormbase.org/db/get?name=Marker39;class=Expr_pattern Marker39] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00006843;class=Gene unc-119] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0003679;class=Anatomy_term neuron] | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00031556;class=Paper WBPaper00031556] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=enIs18;class=Transgene enIs18] | + | | [http://www.wormbase.org/db/get?name=enIs18;class=Transgene enIs18] |
+ | | [lim-7::mfg-e8-gfp] | ||
+ | | GFP | ||
+ | | | ||
+ | | X | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=enIs2;class=Transgene enIs2] | | + | | [http://www.wormbase.org/db/get?name=enIs2;class=Transgene enIs2] |
+ | | | ||
+ | | GFP | ||
+ | | | ||
+ | | X | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=enIs7;class=Transgene enIs7] | + | | [http://www.wormbase.org/db/get?name=enIs7;class=Transgene enIs7] |
+ | | [ced-1::ced-1-GFP; unc-76(+)] | ||
+ | | GFP | ||
+ | | | ||
+ | | X | ||
+ | | [http://www.wormbase.org/db/get?name=Marker40;class=Expr_pattern Marker40] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00000415;class=Gene ced-1] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0007803;class=Anatomy_term engulfing cell] | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00031556;class=Paper WBPaper00031556] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=etIs1;class=Transgene etIs1] | + | | [http://www.wormbase.org/db/get?name=etIs1;class=Transgene etIs1] |
+ | | [ric-19::gfp] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=QC5;class=Strain QC5] | ||
+ | | IV | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=etIs2;class=Transgene etIs2] | + | | [http://www.wormbase.org/db/get?name=etIs2;class=Transgene etIs2] |
+ | | [ric-19::gfp] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=QC47;class=Strain QC47]<br>[http://www.wormbase.org/db/get?name=QC101;class=Strain QC101]<br>[http://www.wormbase.org/db/get?name=QC102;class=Strain QC102]<br>[http://www.wormbase.org/db/get?name=QC103;class=Strain QC103]<br>[http://www.wormbase.org/db/get?name=QC104;class=Strain QC104]<br>[http://www.wormbase.org/db/get?name=QC105;class=Strain QC105] | ||
+ | | III | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=evIs130A;class=Transgene evIs130A] | + | | [http://www.wormbase.org/db/get?name=evIs130A;class=Transgene evIs130A] |
+ | | [mec-7::UNC-40-GFP] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=NW1509;class=Strain NW1509] | ||
+ | | II | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=evIs138;class=Transgene evIs138] | + | | [http://www.wormbase.org/db/get?name=evIs138;class=Transgene evIs138] |
+ | | [plx-2(+); sur-5::gfp] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=NW1696;class=Strain NW1696] | ||
+ | | V | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=evIs54;class=Transgene evIs54] | + | | [http://www.wormbase.org/db/get?name=evIs54;class=Transgene evIs54] |
+ | | [unc-5B::lacZ] | ||
+ | | LacZ | ||
+ | | | ||
+ | | II | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=evIs98;class=Transgene evIs98] | + | | [http://www.wormbase.org/db/get?name=evIs98;class=Transgene evIs98] |
+ | | [unc-5::GFP; dpy-20(+)] | ||
+ | | GFP | ||
+ | | | ||
+ | | V | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=evIs99;class=Transgene evIs99] | + | | [http://www.wormbase.org/db/get?name=evIs99;class=Transgene evIs99] |
+ | | [emb-9::unc-5; emb-9::lacZ; dpy-20(+)] | ||
+ | | LacZ | ||
+ | | | ||
+ | | I | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=ezIs1;class=Transgene ezIs1] | + | | [http://www.wormbase.org/db/get?name=ezIs1;class=Transgene ezIs1] |
+ | | [K09C8.2::gfp, pRF4] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=DZ224;class=Strain DZ224] | ||
+ | | X | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=ezIs10;class=Transgene ezIs10] | + | | [http://www.wormbase.org/db/get?name=ezIs10;class=Transgene ezIs10] |
+ | | [lin-32::gfp] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=DZ390;class=Strain DZ390] | ||
+ | | II | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=ezIs2;class=Transgene ezIs2] | + | | [http://www.wormbase.org/db/get?name=ezIs2;class=Transgene ezIs2] |
+ | | [fkh-6(pro)::gfp, unc-119(+)] transcriptional fusion. | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=DZ325;class=Strain DZ325] | ||
+ | | III | ||
+ | | [http://www.wormbase.org/db/get?name=Expr2972;class=Expr_pattern Expr2972] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00001438;class=Gene fkh-6] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0005175;class=Anatomy_term gonad]<br>[http://www.wormbase.org/db/get?name=WBbt:0005319;class=Anatomy_term spermatheca]<br>[http://www.wormbase.org/db/get?name=WBbt:0004577;class=Anatomy_term Z1]<br>[http://www.wormbase.org/db/get?name=WBbt:0004574;class=Anatomy_term Z4] | ||
+ | | [http://www.wormbase.org/db/get?name=L1%20larva;class=Life_stage L1 larva]<br>[http://www.wormbase.org/db/get?name=L2%20larva;class=Life_stage L2 larva]<br>[http://www.wormbase.org/db/get?name=L3%20larva;class=Life_stage L3 larva]<br>[http://www.wormbase.org/db/get?name=L4%20larva;class=Life_stage L4 larva]<br>[http://www.wormbase.org/db/get?name=adult;class=Life_stage adult] | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00006485;class=Paper WBPaper00006485] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=gaIs27;class=Transgene gaIs27] | + | | [http://www.wormbase.org/db/get?name=gaIs27;class=Transgene gaIs27] |
+ | | [let-23::gfp; rol-6(su1006d)] | ||
+ | | GFP | ||
+ | | | ||
+ | | I | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=gaIs36;class=Transgene gaIs36] | + | | [http://www.wormbase.org/db/get?name=gaIs36;class=Transgene gaIs36] |
+ | | [hs-mpk-1(+); EF1alpha-D-mek(gf); unc-30(+)] | ||
+ | | | ||
+ | | | ||
+ | | V | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=gmIs12;class=Transgene gmIs12] | + | | [http://www.wormbase.org/db/get?name=gmIs12;class=Transgene gmIs12] |
+ | | [srb-6::gfp] | ||
+ | | GFP | ||
+ | | | ||
+ | | III | ||
+ | | [http://www.wormbase.org/db/get?name=Expr3411;class=Expr_pattern Expr3411] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00005071;class=Gene srb-6] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0004364;class=Anatomy_term PHBL]<br>[http://www.wormbase.org/db/get?name=WBbt:0005659;class=Anatomy_term PHBR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004366;class=Anatomy_term PHAL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004365;class=Anatomy_term PHAR] | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00026633;class=Paper WBPaper00026633] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=gmIs13;class=Transgene gmIs13] | + | | [http://www.wormbase.org/db/get?name=gmIs13;class=Transgene gmIs13] |
+ | | [srb-6::gfp; rol-6] | ||
+ | | GFP | ||
+ | | | ||
+ | | II | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=gmIs18;class=Transgene gmIs18] | + | | [http://www.wormbase.org/db/get?name=gmIs18;class=Transgene gmIs18] |
+ | | [ceh-23::gfp] | ||
+ | | GFP | ||
+ | | | ||
+ | | X | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=gmIs20;class=Transgene gmIs20] | + | | [http://www.wormbase.org/db/get?name=gmIs20;class=Transgene gmIs20] |
+ | | [hlh-14::gfp] translational fusion. | ||
+ | | GFP | ||
+ | | | ||
+ | | II | ||
+ | | [http://www.wormbase.org/db/get?name=Expr2897;class=Expr_pattern Expr2897] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00001958;class=Gene hlh-14] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0005970;class=Anatomy_term ABplapppapp]<br>[http://www.wormbase.org/db/get?name=WBbt:0006123;class=Anatomy_term Caapa]<br>[http://www.wormbase.org/db/get?name=WBbt:0006361;class=Anatomy_term ABprapppapa]<br>[http://www.wormbase.org/db/get?name=WBbt:0006234;class=Anatomy_term ABprapppaa]<br>[http://www.wormbase.org/db/get?name=WBbt:0005909;class=Anatomy_term ABprapppa]<br>[http://www.wormbase.org/db/get?name=WBbt:0006697;class=Anatomy_term ABplapppa]<br>[http://www.wormbase.org/db/get?name=WBbt:0006144;class=Anatomy_term ABprapppap]<br>[http://www.wormbase.org/db/get?name=WBbt:0004076;class=Anatomy_term PVQL]<br>[http://www.wormbase.org/db/get?name=WBbt:0005937;class=Anatomy_term ABprapppaap]<br>[http://www.wormbase.org/db/get?name=WBbt:0006743;class=Anatomy_term ABprapppapp]<br>[http://www.wormbase.org/db/get?name=WBbt:0006434;class=Anatomy_term ABplapppap]<br>[http://www.wormbase.org/db/get?name=WBbt:0005935;class=Anatomy_term ABplapppaa]<br>[http://www.wormbase.org/db/get?name=WBbt:0006671;class=Anatomy_term ABplapppaap]<br>[http://www.wormbase.org/db/get?name=WBbt:0004074;class=Anatomy_term PVQR]<br>[http://www.wormbase.org/db/get?name=WBbt:0006208;class=Anatomy_term ABplapppapa] | ||
+ | | [http://www.wormbase.org/db/get?name=proliferating%20embryo;class=Life_stage proliferating embryo] | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00006354;class=Paper WBPaper00006354] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=gmIs21;class=Transgene gmIs21] | + | | [http://www.wormbase.org/db/get?name=gmIs21;class=Transgene gmIs21] |
+ | | [nlp-1::gfp] | ||
+ | | GFP | ||
+ | | | ||
+ | | II | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=gmIs22;class=Transgene gmIs22] | + | | [http://www.wormbase.org/db/get?name=gmIs22;class=Transgene gmIs22] |
+ | | [nlp-1::gfp] | ||
+ | | GFP | ||
+ | | | ||
+ | | V | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | + | | [http://www.wormbase. | |
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=gqIs35;class=Transgene gqIs35] | + | | [http://www.wormbase.org/db/get?name=gqIs35;class=Transgene gqIs35] |
+ | | [rab-3::ppk-1-GFP, lin-15(+)] | ||
+ | | GFP | ||
+ | | | ||
+ | | IV | ||
+ | | [http://www.wormbase.org/db/get?name=Expr7821;class=Expr_pattern Expr7821] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00004087;class=Gene ppk-1] | ||
+ | | | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00031242;class=Paper WBPaper00031242] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=gqIs37;class=Transgene gqIs37] | + | | [http://www.wormbase.org/db/get?name=gqIs37;class=Transgene gqIs37] |
+ | | [unc-47::ppk-1; myo-2:GFP] | ||
+ | | GFP | ||
+ | | | ||
+ | | II | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=hdIs10;class=Transgene hdIs10] | + | | [http://www.wormbase.org/db/get?name=hdIs10;class=Transgene hdIs10] |
+ | | [unc-129::CFP, glr-1::YFP, unc-47::DsRed, hsp-16::rol-6] | ||
+ | | CFP, YFP, DsRed | ||
+ | | [http://www.wormbase.org/db/get?name=VH715;class=Strain VH715]<br>[http://www.wormbase.org/db/get?name=VH318;class=Strain VH318] | ||
+ | | V | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=hdIs14;class=Transgene hdIs14] | + | | [http://www.wormbase.org/db/get?name=hdIs14;class=Transgene hdIs14] |
+ | | [odr-2::CFP, unc-129::YFP, glr-1::DsRed, hsp-16::rol-6] | ||
+ | | CFP, YFP, DsRed | ||
+ | | [http://www.wormbase.org/db/get?name=VH414;class=Strain VH414]<br>[http://www.wormbase.org/db/get?name=VH431;class=Strain VH431] | ||
+ | | IV | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=hdIs17;class=Transgene hdIs17] | + | | [http://www.wormbase.org/db/get?name=hdIs17;class=Transgene hdIs17] |
+ | | [glr-1::YFP, unc-47::YFP, unc-129::YFP, rol-6(su1006)] | ||
+ | | YFP | ||
+ | | [http://www.wormbase.org/db/get?name=VH715;class=Strain VH715] | ||
+ | | I | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=hdIs26;class=Transgene hdIs26] | + | | [http://www.wormbase.org/db/get?name=hdIs26;class=Transgene hdIs26] |
+ | | [odr-2::CFP, sra-6::DsRed2] | ||
+ | | CFP, DsRed2 | ||
+ | | [http://www.wormbase.org/db/get?name=VH648;class=Strain VH648] | ||
+ | | III | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=hdIs32;class=Transgene hdIs32] | + | | [http://www.wormbase.org/db/get?name=hdIs32;class=Transgene hdIs32] |
+ | | [glr-1:DsRed2] | ||
+ | | DsRed2 | ||
+ | | [http://www.wormbase.org/db/get?name=VH804;class=Strain VH804] | ||
+ | | III | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=icIs103;class=Transgene icIs103] | + | | [http://www.wormbase.org/db/get?name=icIs103;class=Transgene icIs103] |
+ | | [hlh-3::gfp] | ||
+ | | GFP | ||
+ | | | ||
+ | | V | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=idIs5;class=Transgene idIs5] | + | | [http://www.wormbase.org/db/get?name=idIs5;class=Transgene idIs5] |
+ | | [fem-1::lacz] | ||
+ | | LacZ | ||
+ | | | ||
+ | | V | ||
+ | | [http://www.wormbase.org/db/get?name=Expr674;class=Expr_pattern Expr674] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00001411;class=Gene fem-1] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0004017;class=Anatomy_term Cell] | ||
+ | | [http://www.wormbase.org/db/get?name=embryo;class=Life_stage embryo]<br>[http://www.wormbase.org/db/get?name=L1%20larva;class=Life_stage L1 larva]<br>[http://www.wormbase.org/db/get?name=L2%20larva;class=Life_stage L2 larva]<br>[http://www.wormbase.org/db/get?name=L3%20larva;class=Life_stage L3 larva]<br>[http://www.wormbase.org/db/get?name=L4%20larva;class=Life_stage L4 larva]<br>[http://www.wormbase.org/db/get?name=adult%20male;class=Life_stage adult male]<br>[http://www.wormbase.org/db/get?name=adult;class=Life_stage adult] | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00002504;class=Paper WBPaper00002504] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=idIs6;class=Transgene idIs6] | + | | [http://www.wormbase.org/db/get?name=idIs6;class=Transgene idIs6] |
+ | | [fem-1::lacz] | ||
+ | | LacZ | ||
+ | | | ||
+ | | II | ||
+ | | [http://www.wormbase.org/db/get?name=Expr674;class=Expr_pattern Expr674] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00001411;class=Gene fem-1] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0004017;class=Anatomy_term Cell] | ||
+ | | [http://www.wormbase.org/db/get?name=embryo;class=Life_stage embryo]<br>[http://www.wormbase.org/db/get?name=L1%20larva;class=Life_stage L1 larva]<br>[http://www.wormbase.org/db/get?name=L2%20larva;class=Life_stage L2 larva]<br>[http://www.wormbase.org/db/get?name=L3%20larva;class=Life_stage L3 larva]<br>[http://www.wormbase.org/db/get?name=L4%20larva;class=Life_stage L4 larva]<br>[http://www.wormbase.org/db/get?name=adult%20male;class=Life_stage adult male]<br>[http://www.wormbase.org/db/get?name=adult;class=Life_stage adult] | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00002504;class=Paper WBPaper00002504] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=inIs181;class=Transgene inIs181] | + | | [http://www.wormbase.org/db/get?name=inIs181;class=Transgene inIs181] |
+ | | [ida-1::gfp] translational fusion, which contains a 2443 bp ida-1 promoter upstream of an ida-1 coding region that incorporates introns 3-9 followed at the 3'-end with in-frame GFP coding sequence and terminating with the unc-54 3'-untranslated region. | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=BL5752;class=Strain BL5752]<br>[http://www.wormbase.org/db/get?name=BL5750;class=Strain BL5750] | ||
+ | | IV | ||
+ | | [http://www.wormbase.org/db/get?name=Expr2970;class=Expr_pattern Expr2970] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00002048;class=Gene ida-1] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0004757;class=Anatomy_term HSNR]<br>[http://www.wormbase.org/db/get?name=WBbt:0005394;class=Anatomy_term amphid neuron]<br>[http://www.wormbase.org/db/get?name=WBbt:0003955;class=Anatomy_term ALA]<br>[http://www.wormbase.org/db/get?name=WBbt:0004619;class=Anatomy_term VC2]<br>[http://www.wormbase.org/db/get?name=WBbt:0004621;class=Anatomy_term VC1]<br>[http://www.wormbase.org/db/get?name=WBbt:0004362;class=Anatomy_term PHCL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004617;class=Anatomy_term VC4]<br>[http://www.wormbase.org/db/get?name=WBbt:0004118;class=Anatomy_term PHCR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004618;class=Anatomy_term VC3]<br>[http://www.wormbase.org/db/get?name=WBbt:0004611;class=Anatomy_term VC6]<br>[http://www.wormbase.org/db/get?name=WBbt:0004613;class=Anatomy_term VC5]<br>[http://www.wormbase.org/db/get?name=WBbt:0004758;class=Anatomy_term HSNL] | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00013484;class=Paper WBPaper00013484] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=inIs182;class=Transgene inIs182] | + | | [http://www.wormbase.org/db/get?name=inIs182;class=Transgene inIs182] |
+ | | [ida-1::gfp] translational fusion, which contains a 2443 bp ida-1 promoter upstream of an ida-1 coding region that incorporates introns 3-9 followed at the 3'-end with in-frame GFP coding sequence and terminating with the unc-54 3'-untranslated region. | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=BL5752;class=Strain BL5752]<br>[http://www.wormbase.org/db/get?name=BL5751;class=Strain BL5751] | ||
+ | | I | ||
+ | | [http://www.wormbase.org/db/get?name=Expr2970;class=Expr_pattern Expr2970] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00002048;class=Gene ida-1] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0004757;class=Anatomy_term HSNR]<br>[http://www.wormbase.org/db/get?name=WBbt:0005394;class=Anatomy_term amphid neuron]<br>[http://www.wormbase.org/db/get?name=WBbt:0003955;class=Anatomy_term ALA]<br>[http://www.wormbase.org/db/get?name=WBbt:0004619;class=Anatomy_term VC2]<br>[http://www.wormbase.org/db/get?name=WBbt:0004621;class=Anatomy_term VC1]<br>[http://www.wormbase.org/db/get?name=WBbt:0004362;class=Anatomy_term PHCL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004617;class=Anatomy_term VC4]<br>[http://www.wormbase.org/db/get?name=WBbt:0004118;class=Anatomy_term PHCR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004618;class=Anatomy_term VC3]<br>[http://www.wormbase.org/db/get?name=WBbt:0004611;class=Anatomy_term VC6]<br>[http://www.wormbase.org/db/get?name=WBbt:0004613;class=Anatomy_term VC5]<br>[http://www.wormbase.org/db/get?name=WBbt:0004758;class=Anatomy_term HSNL] | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00013484;class=Paper WBPaper00013484] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=irIs21;class=Transgene irIs21] | + | | [http://www.wormbase.org/db/get?name=irIs21;class=Transgene irIs21] |
+ | | [elt-2::YFP] | ||
+ | | YFP | ||
+ | | | ||
+ | | V | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=irIs25;class=Transgene irIs25] | + | | [http://www.wormbase.org/db/get?name=irIs25;class=Transgene irIs25] |
+ | | [elt-2::GFP] | ||
+ | | GFP | ||
+ | | | ||
+ | | V | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=irIs42;class=Transgene irIs42] | + | | [http://www.wormbase.org/db/get?name=irIs42;class=Transgene irIs42] |
+ | | [hsp-16.1::tbx-35]. A hs-tbx-35 construct (pGB223) was built by cloning a PCR-amplified genomic fragment containing the coding region and introns into plasmid pPD49.83. | ||
+ | | | ||
+ | | | ||
+ | | X | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=jcIs1;class=Transgene jcIs1] | + | | [http://www.wormbase.org/db/get?name=jcIs1;class=Transgene jcIs1] |
+ | | [ajm-1::gfp; unc-29(+); rol-6(su1006)] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=BP76;class=Strain BP76]<br>[http://www.wormbase.org/db/get?name=BR2958;class=Strain BR2958]<br>[http://www.wormbase.org/db/get?name=NW1615;class=Strain NW1615]<br>[http://www.wormbase.org/db/get?name=NW1702;class=Strain NW1702]<br>[http://www.wormbase.org/db/get?name=NW1704;class=Strain NW1704]<br>[http://www.wormbase.org/db/get?name=OH4129;class=Strain OH4129]<br>[http://www.wormbase.org/db/get?name=SU93;class=Strain SU93]<br>[http://www.wormbase.org/db/get?name=SU180;class=Strain SU180]<br>[http://www.wormbase.org/db/get?name=WH171;class=Strain WH171]<br>[http://www.wormbase.org/db/get?name=DF67;class=Strain DF67] | ||
+ | | IV | ||
+ | | [http://www.wormbase.org/db/get?name=Expr1682;class=Expr_pattern Expr1682] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00000100;class=Gene ajm-1] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0003672;class=Anatomy_term epithelial cell] | ||
+ | | [http://www.wormbase.org/db/get?name=all%20stages;class=Life_stage all stages] | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00004961;class=Paper WBPaper00004961] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=jeIs1;class=Transgene jeIs1] | + | | [http://www.wormbase.org/db/get?name=jeIs1;class=Transgene jeIs1] |
+ | | [mec-7::lacZ] translational fusion, with 850bp 5'UTR, 792 bp mec-7 coding region, for the N-term 206 amino acids, lacZ coding region, and 1.3 kb of unc-54 3' UTR. | ||
+ | | LacZ | ||
+ | | [http://www.wormbase.org/db/get?name=JW29;class=Strain JW29] | ||
+ | | I | ||
+ | | [http://www.wormbase.org/db/get?name=Expr1504;class=Expr_pattern Expr1504] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00003171;class=Gene mec-7] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0004797;class=Anatomy_term FLPR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004086;class=Anatomy_term PVM]<br>[http://www.wormbase.org/db/get?name=WBbt:0004103;class=Anatomy_term PLMR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003953;class=Anatomy_term ALMR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003939;class=Anatomy_term ALNL]<br>[http://www.wormbase.org/db/get?name=WBbt:0003937;class=Anatomy_term ALNR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003954;class=Anatomy_term ALML]<br>[http://www.wormbase.org/db/get?name=WBbt:0003832;class=Anatomy_term AVM]<br>[http://www.wormbase.org/db/get?name=WBbt:0004104;class=Anatomy_term PLML]<br>[http://www.wormbase.org/db/get?name=WBbt:0004798;class=Anatomy_term FLPL] | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00001570;class=Paper WBPaper00001570] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=jjIs0709;class=Transgene jjIs0709] | + | | [http://www.wormbase.org/db/get?name=jjIs0709;class=Transgene jjIs0709] |
+ | | [lmn-1p::gfp-lmn-1-unc-54 3UTR); pMH86(dpy-20(+)] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=LW0709;class=Strain LW0709] | ||
+ | | I | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=jjIs64;class=Transgene jjIs64] | + | | [http://www.wormbase.org/db/get?name=jjIs64;class=Transgene jjIs64] |
+ | | [arg-1::gfp] | ||
+ | | GFP | ||
+ | | | ||
+ | | V | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=jsIs37;class=Transgene jsIs37] | + | | [http://www.wormbase.org/db/get?name=jsIs37;class=Transgene jsIs37] |
+ | | [mec-7::snb-1-gfp] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=NM664;class=Strain NM664]<br>[http://www.wormbase.org/db/get?name=NM1448;class=Strain NM1448]<br>[http://www.wormbase.org/db/get?name=NM1455;class=Strain NM1455]<br>[http://www.wormbase.org/db/get?name=NM1489;class=Strain NM1489]<br>[http://www.wormbase.org/db/get?name=NM2040;class=Strain NM2040] | ||
+ | | V | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=jsIs40;class=Transgene jsIs40] | + | | [http://www.wormbase.org/db/get?name=jsIs40;class=Transgene jsIs40] |
+ | | [mec-7::snb-1-gfp] | ||
+ | | GFP | ||
+ | | | ||
+ | | I | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=jsIs682;class=Transgene jsIs682] | + | | [http://www.wormbase.org/db/get?name=jsIs682;class=Transgene jsIs682] |
+ | | [rab-3::GFP-RAB-3] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=NM2415;class=Strain NM2415] | ||
+ | | III | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=juIs73;class=Transgene juIs73] | + | | [http://www.wormbase.org/db/get?name=juIs73;class=Transgene juIs73] |
+ | | [unc-25::gfp] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=IC700;class=Strain IC700]<br>[http://www.wormbase.org/db/get?name=CZ1197;class=Strain CZ1197] | ||
+ | | III | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=juIs76;class=Transgene juIs76] | + | | [http://www.wormbase.org/db/get?name=juIs76;class=Transgene juIs76] |
+ | | [unc-25::gfp] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=CZ1632;class=Strain CZ1632]<br>[http://www.wormbase.org/db/get?name=CZ1758;class=Strain CZ1758]<br>[http://www.wormbase.org/db/get?name=CZ1931;class=Strain CZ1931]<br>[http://www.wormbase.org/db/get?name=CZ1935;class=Strain CZ1935]<br>[http://www.wormbase.org/db/get?name=OH4121;class=Strain OH4121]<br>[http://www.wormbase.org/db/get?name=OH4128;class=Strain OH4128]<br>[http://www.wormbase.org/db/get?name=CZ1200;class=Strain CZ1200] | ||
+ | | II | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=kcIs21;class=Transgene kcIs21] | + | | [http://www.wormbase.org/db/get?name=kcIs21;class=Transgene kcIs21] |
+ | | [ifb-2::ifb-2-cfp] translational fusion. A plasmid construct encoding IFB-2::CFP was prepared by first amplifying the 1,994 bp ifb-2 promoter fragment from genomic DNA with the help of amplimers 05-143 (5' -CCG CCG AAG CTT CCA TAG GGA AAT CGT GTT ATC-3') and 05-144 (5' -CCG CCG CTG CAG GAT GAA GTC GCT AAA ATT TTG-3'). The HindIII/PstI-cleaved fragment was inserted into the HindIII/PstI sites of the cfp-containing vector pVH10.10, thereby generating plasmid pPifb-2:cfp. For cloning of the 1,646 bp ifb-2 cDNA fragment, ifb-2 cDNA was amplified by PCR using primers 05-145 (5' -CCA CCA CTG CAG ATG TCG GCG GTT AGT TAT TCG-3') and 05-146 (5' -TTA TTA CTG CAG GCA GCG ACC GTC GTC TGG ATG-3'). The PstI-digested product was finally inserted into pPifb-2:cfp to produce pifb-2::cfp. Correct cloning was confirmed by DNA sequencing. | ||
+ | | CFP | ||
+ | | [http://www.wormbase.org/db/get?name=BJ52;class=Strain BJ52] | ||
+ | | V | ||
+ | | [http://www.wormbase.org/db/get?name=Expr8186;class=Expr_pattern Expr8186] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00002054;class=Gene ifb-2] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0005772;class=Anatomy_term intestine] | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00031849;class=Paper WBPaper00031849] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=kuIs27;class=Transgene kuIs27] | + | | [http://www.wormbase.org/db/get?name=kuIs27;class=Transgene kuIs27] |
+ | | [egl-13::gfp] translational fusion. | ||
+ | | GFP | ||
+ | | | ||
+ | | IV | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=kuIs29;class=Transgene kuIs29] | + | | [http://www.wormbase.org/db/get?name=kuIs29;class=Transgene kuIs29] |
+ | | [egl-13::gfp; unc-119(+)] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=MH1317;class=Strain MH1317] | ||
+ | | V | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=kuIs34;class=Transgene kuIs34] | + | | [http://www.wormbase.org/db/get?name=kuIs34;class=Transgene kuIs34] |
+ | | [sem-4::gfp] translational fusion. A translational fusion containing a SphIPstI genomic fragment, encoding approximately half of SEM-4, fused in frame to GFP. | ||
+ | | GFP | ||
+ | | | ||
+ | | IV | ||
+ | | [http://www.wormbase.org/db/get?name=Expr949;class=Expr_pattern Expr949] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00004773;class=Gene sem-4] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0004757;class=Anatomy_term HSNR]<br>[http://www.wormbase.org/db/get?name=WBbt:0006896;class=Anatomy_term P8.p]<br>[http://www.wormbase.org/db/get?name=WBbt:0004788;class=Anatomy_term rect_D]<br>[http://www.wormbase.org/db/get?name=WBbt:0004380;class=Anatomy_term hyp9]<br>[http://www.wormbase.org/db/get?name=WBbt:0004821;class=Anatomy_term DVC]<br>[http://www.wormbase.org/db/get?name=WBbt:0003825;class=Anatomy_term B]<br>[http://www.wormbase.org/db/get?name=WBbt:0006891;class=Anatomy_term P3.p]<br>[http://www.wormbase.org/db/get?name=WBbt:0004378;class=Anatomy_term hyp10]<br>[http://www.wormbase.org/db/get?name=WBbt:0005300;class=Anatomy_term ventral cord neuron]<br>[http://www.wormbase.org/db/get?name=WBbt:0004381;class=Anatomy_term hyp8]<br>[http://www.wormbase.org/db/get?name=WBbt:0006893;class=Anatomy_term P5.p]<br>[http://www.wormbase.org/db/get?name=WBbt:0006894;class=Anatomy_term P6.p]<br>[http://www.wormbase.org/db/get?name=WBbt:0005448;class=Anatomy_term preanal ganglion]<br>[http://www.wormbase.org/db/get?name=WBbt:0006895;class=Anatomy_term P7.p]<br>[http://www.wormbase.org/db/get?name=WBbt:0005739;class=Anatomy_term head]<br>[http://www.wormbase.org/db/get?name=WBbt:0004799;class=Anatomy_term F]<br>[http://www.wormbase.org/db/get?name=WBbt:0006892;class=Anatomy_term P4.p]<br>[http://www.wormbase.org/db/get?name=WBbt:0004758;class=Anatomy_term HSNL] | ||
+ | | [http://www.wormbase.org/db/get?name=L2%20larva;class=Life_stage L2 larva] | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00004300;class=Paper WBPaper00004300] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=kuIs34;class=Transgene kuIs34] | + | | [http://www.wormbase.org/db/get?name=kuIs34;class=Transgene kuIs34] |
+ | | [sem-4::gfp] translational fusion. A translational fusion containing a SphIPstI genomic fragment, encoding approximately half of SEM-4, fused in frame to GFP. | ||
+ | | GFP | ||
+ | | | ||
+ | | IV | ||
+ | | [http://www.wormbase.org/db/get?name=Expr8184;class=Expr_pattern Expr8184] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00004773;class=Gene sem-4] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0004578;class=Anatomy_term Y]<br>[http://www.wormbase.org/db/get?name=WBbt:0003825;class=Anatomy_term B]<br>[http://www.wormbase.org/db/get?name=WBbt:0004942;class=Anatomy_term U]<br>[http://www.wormbase.org/db/get?name=WBbt:0004499;class=Anatomy_term K]<br>[http://www.wormbase.org/db/get?name=WBbt:0004799;class=Anatomy_term F]<br>[http://www.wormbase.org/db/get?name=WBbt:0004497;class=Anatomy_term K'] | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00031556;class=Paper WBPaper00031556] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=kuIs46;class=Transgene kuIs46] | + | | [http://www.wormbase.org/db/get?name=kuIs46;class=Transgene kuIs46] |
+ | | [ajm-1::gfp; unc-119(+)] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=MH1384;class=Strain MH1384] | ||
+ | | X | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=kyIs104;class=Transgene kyIs104] | + | | [http://www.wormbase.org/db/get?name=kyIs104;class=Transgene kyIs104] |
+ | | [str-1::gfp] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=CX3553;class=Strain CX3553]<br>[http://www.wormbase.org/db/get?name=PY2223;class=Strain PY2223]<br>[http://www.wormbase.org/db/get?name=PY2285;class=Strain PY2285]<br>[http://www.wormbase.org/db/get?name=PY2289;class=Strain PY2289] | ||
+ | | X | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=kyIs105;class=Transgene kyIs105] | + | | [http://www.wormbase.org/db/get?name=kyIs105;class=Transgene kyIs105] |
+ | | [str-3::SNB-1::GFP] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=CX3572;class=Strain CX3572] | ||
+ | | V | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=kyIs128;class=Transgene kyIs128] | + | | [http://www.wormbase.org/db/get?name=kyIs128;class=Transgene kyIs128] |
+ | | [str-3::gfp] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=CX3596;class=Strain CX3596] | ||
+ | | X | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=kyIs130;class=Transgene kyIs130] | + | | [http://www.wormbase.org/db/get?name=kyIs130;class=Transgene kyIs130] |
+ | | [str-2::snb-1::GFP, lin-15(+)] | ||
+ | | GFP | ||
+ | | | ||
+ | | X | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=kyIs131;class=Transgene kyIs131] | + | | [http://www.wormbase.org/db/get?name=kyIs131;class=Transgene kyIs131] |
+ | | [str-2::gfp] | ||
+ | | GFP | ||
+ | | | ||
+ | | IV | ||
+ | | [http://www.wormbase.org/db/get?name=Expr1165;class=Expr_pattern Expr1165] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00006070;class=Gene str-2] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0003887;class=Anatomy_term ASIR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003826;class=Anatomy_term AWCR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003827;class=Anatomy_term AWCL]<br>[http://www.wormbase.org/db/get?name=WBbt:0003888;class=Anatomy_term ASIL] | ||
+ | | [http://www.wormbase.org/db/get?name=fully-elongated%20embryo;class=Life_stage fully-elongated embryo]<br>[http://www.wormbase.org/db/get?name=L1%20larva;class=Life_stage L1 larva] | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00003760;class=Paper WBPaper00003760] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=kyIs136;class=Transgene kyIs136] | + | | [http://www.wormbase.org/db/get?name=kyIs136;class=Transgene kyIs136] |
+ | | [str-2::GFP, lin-15(+)] | ||
+ | | GFP | ||
+ | | | ||
+ | | X | ||
+ | | [http://www.wormbase.org/db/get?name=Expr1165;class=Expr_pattern Expr1165] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00006070;class=Gene str-2] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0003887;class=Anatomy_term ASIR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003826;class=Anatomy_term AWCR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003827;class=Anatomy_term AWCL]<br>[http://www.wormbase.org/db/get?name=WBbt:0003888;class=Anatomy_term ASIL] | ||
+ | | [http://www.wormbase.org/db/get?name=fully-elongated%20embryo;class=Life_stage fully-elongated embryo]<br>[http://www.wormbase.org/db/get?name=L1%20larva;class=Life_stage L1 larva] | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00003760;class=Paper WBPaper00003760] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=kyIs137;class=Transgene kyIs137] | + | | [http://www.wormbase.org/db/get?name=kyIs137;class=Transgene kyIs137] |
+ | | str-2::gfp | ||
+ | | GFP | ||
+ | | | ||
+ | | V | ||
+ | | [http://www.wormbase.org/db/get?name=Expr1165;class=Expr_pattern Expr1165] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00006070;class=Gene str-2] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0003887;class=Anatomy_term ASIR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003826;class=Anatomy_term AWCR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003827;class=Anatomy_term AWCL]<br>[http://www.wormbase.org/db/get?name=WBbt:0003888;class=Anatomy_term ASIL] | ||
+ | | [http://www.wormbase.org/db/get?name=fully-elongated%20embryo;class=Life_stage fully-elongated embryo]<br>[http://www.wormbase.org/db/get?name=L1%20larva;class=Life_stage L1 larva] | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00003760;class=Paper WBPaper00003760] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=kyIs140;class=Transgene kyIs140] | + | | [http://www.wormbase.org/db/get?name=kyIs140;class=Transgene kyIs140] |
+ | | str-2::gfp | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=CX3695;class=Strain CX3695]<br>[http://www.wormbase.org/db/get?name=CX3933;class=Strain CX3933]<br>[http://www.wormbase.org/db/get?name=CX3940;class=Strain CX3940]<br>[http://www.wormbase.org/db/get?name=CX4828;class=Strain CX4828]<br>[http://www.wormbase.org/db/get?name=CX4998;class=Strain CX4998]<br>[http://www.wormbase.org/db/get?name=CX5757;class=Strain CX5757]<br>[http://www.wormbase.org/db/get?name=CX5893;class=Strain CX5893]<br>[http://www.wormbase.org/db/get?name=CX5922;class=Strain CX5922]<br>[http://www.wormbase.org/db/get?name=OH4768;class=Strain OH4768]<br>[http://www.wormbase.org/db/get?name=PY1133;class=Strain PY1133]<br>[http://www.wormbase.org/db/get?name=LG313;class=Strain LG313] | ||
+ | | I | ||
+ | | [http://www.wormbase.org/db/get?name=Expr1165;class=Expr_pattern Expr1165] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00006070;class=Gene str-2] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0003887;class=Anatomy_term ASIR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003826;class=Anatomy_term AWCR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003827;class=Anatomy_term AWCL]<br>[http://www.wormbase.org/db/get?name=WBbt:0003888;class=Anatomy_term ASIL] | ||
+ | | [http://www.wormbase.org/db/get?name=fully-elongated%20embryo;class=Life_stage fully-elongated embryo]<br>[http://www.wormbase.org/db/get?name=L1%20larva;class=Life_stage L1 larva] | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00003760;class=Paper WBPaper00003760] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=kyIs150;class=Transgene kyIs150] | + | | [http://www.wormbase.org/db/get?name=kyIs150;class=Transgene kyIs150] |
+ | | [tax-2(deletion)::gfp] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=CX4103;class=Strain CX4103] | ||
+ | | IV | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=kyIs156;class=Transgene kyIs156] | + | | [http://www.wormbase.org/db/get?name=kyIs156;class=Transgene kyIs156] |
+ | | [str-1::odr-10-gfp]. | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=CX3877;class=Strain CX3877] | ||
+ | | X | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=kyIs164;class=Transgene kyIs164] | + | | [http://www.wormbase.org/db/get?name=kyIs164;class=Transgene kyIs164] |
+ | | [gcy-5::gfp] | ||
+ | | GFP | ||
+ | | | ||
+ | | II | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=kyIs170;class=Transgene kyIs170] | + | | [http://www.wormbase.org/db/get?name=kyIs170;class=Transgene kyIs170] |
+ | | [srh-220::gfp, lin-15(+)] | ||
+ | | GFP | ||
+ | | | ||
+ | | I | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=kyIs174;class=Transgene kyIs174] | + | | [http://www.wormbase.org/db/get?name=kyIs174;class=Transgene kyIs174] |
+ | | [slt-1::gfp] transcriptional fusion, with 4 kb of potential regulatory sequence upstream of the slt-1 initiator methionine, with the first two codons of slt-1. | ||
+ | | GFP | ||
+ | | | ||
+ | | V | ||
+ | | [http://www.wormbase.org/db/get?name=Expr1639;class=Expr_pattern Expr1639] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00004854;class=Gene slt-1] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0004694;class=Anatomy_term hyp1]<br>[http://www.wormbase.org/db/get?name=WBbt:0004690;class=Anatomy_term hyp3]<br>[http://www.wormbase.org/db/get?name=WBbt:0004679;class=Anatomy_term hyp6]<br>[http://www.wormbase.org/db/get?name=WBbt:0005027;class=Anatomy_term RMED]<br>[http://www.wormbase.org/db/get?name=WBbt:0003812;class=Anatomy_term BDUL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004685;class=Anatomy_term hyp5]<br>[http://www.wormbase.org/db/get?name=WBbt:0005813;class=Anatomy_term body wall musculature]<br>[http://www.wormbase.org/db/get?name=WBbt:0005750;class=Anatomy_term socket cell]<br>[http://www.wormbase.org/db/get?name=WBbt:0003928;class=Anatomy_term RIH]<br>[http://www.wormbase.org/db/get?name=WBbt:0003811;class=Anatomy_term BDUR]<br>[http://www.wormbase.org/db/get?name=WBbt:0005798;class=Anatomy_term anal sphincter muscle]<br>[http://www.wormbase.org/db/get?name=WBbt:0004692;class=Anatomy_term hyp2]<br>[http://www.wormbase.org/db/get?name=WBbt:0004687;class=Anatomy_term hyp4] | ||
+ | | [http://www.wormbase.org/db/get?name=comma%20embryo;class=Life_stage comma embryo]<br>[http://www.wormbase.org/db/get?name=1.5-fold%20embryo;class=Life_stage 1.5-fold embryo]<br>[http://www.wormbase.org/db/get?name=2-fold%20embryo;class=Life_stage 2-fold embryo]<br>[http://www.wormbase.org/db/get?name=3-fold%20embryo;class=Life_stage 3-fold embryo]<br>[http://www.wormbase.org/db/get?name=fully-elongated%20embryo;class=Life_stage fully-elongated embryo]<br>[http://www.wormbase.org/db/get?name=larva;class=Life_stage larva]<br>[http://www.wormbase.org/db/get?name=adult;class=Life_stage adult] | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00004900;class=Paper WBPaper00004900] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=kyIs179;class=Transgene kyIs179] | + | | [http://www.wormbase.org/db/get?name=kyIs179;class=Transgene kyIs179] |
+ | | [unc-86::gfp, lin-15(+)] | ||
+ | | GFP | ||
+ | | | ||
+ | | IV | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=kyIs192;class=Transgene kyIs192] | + | | [http://www.wormbase.org/db/get?name=kyIs192;class=Transgene kyIs192] |
+ | | [mec-7::myr::unc-40, str-1::gfp] | ||
+ | | GFP | ||
+ | | | ||
+ | | II | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=kyIs200;class=Transgene kyIs200] | + | | [http://www.wormbase.org/db/get?name=kyIs200;class=Transgene kyIs200] |
+ | | [sra-6::VR1(cDNA)(100ng); elt-2::gfp(10ng)] | ||
+ | | VR1. VR1 is the mammalian TRPV1 channel that share similarity to OSM-9 in C. elegans. --wjc. | ||
+ | | | ||
+ | | X | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=kyIs209;class=Transgene kyIs209] | + | | [http://www.wormbase.org/db/get?name=kyIs209;class=Transgene kyIs209] |
+ | | [myo-3::slt-1]. Integrant of myo-3::slt-1 misexpressing slt-1 in all body wall muscles | ||
+ | | | ||
+ | | | ||
+ | | X | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=kyIs218;class=Transgene kyIs218] | + | | [http://www.wormbase.org/db/get?name=kyIs218;class=Transgene kyIs218] |
+ | | [myo-3::slt-1]. The full-length slt-1 cDNA was cloned into the KpnI/SacI sites of pPD96.52, directly downstream of the myo-3 promoter. | ||
+ | | | ||
+ | | | ||
+ | | X | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=kyIs235;class=Transgene kyIs235] | + | | [http://www.wormbase.org/db/get?name=kyIs235;class=Transgene kyIs235] |
+ | | [unc-86::snb-1::yfp, unc-4::lin-10::dsRED, odr-1::dsRED] | ||
+ | | YFP | ||
+ | | [http://www.wormbase.org/db/get?name=CX652;class=Strain CX652] | ||
+ | | V | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=kyIs258;class=Transgene kyIs258] | + | | [http://www.wormbase.org/db/get?name=kyIs258;class=Transgene kyIs258] |
+ | | [odr-1::DsRed, unc-122::GFP] | ||
+ | | GFP | ||
+ | | | ||
+ | | X | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=kyIs262;class=Transgene kyIs262] | + | | [http://www.wormbase.org/db/get?name=kyIs262;class=Transgene kyIs262] |
+ | | [unc-86::myr-GFP, odr-1::dsred] | ||
+ | | GFP | ||
+ | | | ||
+ | | IV | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=kyIs29;class=Transgene kyIs29] | + | | [http://www.wormbase.org/db/get?name=kyIs29;class=Transgene kyIs29] |
+ | | [glr-1::gfp] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=CX2835;class=Strain CX2835] | ||
+ | | X | ||
+ | | [http://www.wormbase.org/db/get?name=Expr247;class=Expr_pattern Expr247] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00001612;class=Gene glr-1] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0003870;class=Anatomy_term AVAL]<br>[http://www.wormbase.org/db/get?name=WBbt:0003985;class=Anatomy_term AIBL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004094;class=Anatomy_term PVCL]<br>[http://www.wormbase.org/db/get?name=WBbt:0003866;class=Anatomy_term AVDL]<br>[http://www.wormbase.org/db/get?name=WBbt:0003869;class=Anatomy_term AVAR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003868;class=Anatomy_term AVBL]<br>[http://www.wormbase.org/db/get?name=WBbt:0005353;class=Anatomy_term SMD]<br>[http://www.wormbase.org/db/get?name=WBbt:0005346;class=Anatomy_term URY]<br>[http://www.wormbase.org/db/get?name=WBbt:0003984;class=Anatomy_term AIBR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004092;class=Anatomy_term PVCR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003863;class=Anatomy_term AVER]<br>[http://www.wormbase.org/db/get?name=WBbt:0004076;class=Anatomy_term PVQL]<br>[http://www.wormbase.org/db/get?name=WBbt:0003865;class=Anatomy_term AVDR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003850;class=Anatomy_term AVG]<br>[http://www.wormbase.org/db/get?name=WBbt:0005053;class=Anatomy_term RIMR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003926;class=Anatomy_term RIML]<br>[http://www.wormbase.org/db/get?name=WBbt:0003867;class=Anatomy_term AVBR]<br>[http://www.wormbase.org/db/get?name=WBbt:0005400;class=Anatomy_term RMD]<br>[http://www.wormbase.org/db/get?name=WBbt:0003864;class=Anatomy_term AVEL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004074;class=Anatomy_term PVQR] | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00002308;class=Paper WBPaper00002308] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=kyIs299;class=Transgene kyIs299] | + | | [http://www.wormbase.org/db/get?name=kyIs299;class=Transgene kyIs299] |
+ | | [hsp16-2::unc-6::HA; unc-86::myr-GFP; odr-1::DsRed] | ||
+ | | GFP | ||
+ | | | ||
+ | | X | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=kyIs323;class=Transgene kyIs323] | + | | [http://www.wormbase.org/db/get?name=kyIs323;class=Transgene kyIs323] |
+ | | [str-2::GFP, unc-122::GFP] | ||
+ | | GFP | ||
+ | | | ||
+ | | II | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=kyIs37;class=Transgene kyIs37] | + | | [http://www.wormbase.org/db/get?name=kyIs37;class=Transgene kyIs37] |
+ | | [odr-10::gfp]. With the odr-10 promoter and the first 6 amino acids of ODR-10 fused to GFP. | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=CX3260;class=Strain CX3260] | ||
+ | | II | ||
+ | | [http://www.wormbase.org/db/get?name=Expr280;class=Expr_pattern Expr280] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00003856;class=Gene odr-10] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0003831;class=Anatomy_term AWAL]<br>[http://www.wormbase.org/db/get?name=WBbt:0003830;class=Anatomy_term AWAR] | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00002421;class=Paper WBPaper00002421] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=kyIs38;class=Transgene kyIs38] | + | | [http://www.wormbase.org/db/get?name=kyIs38;class=Transgene kyIs38] |
+ | | [odr-7p::gfp] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=PY1060;class=Strain PY1060] | ||
+ | | X | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=kyIs39;class=Transgene kyIs39] | + | | [http://www.wormbase.org/db/get?name=kyIs39;class=Transgene kyIs39] |
+ | | [sra-6::gfp] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=CX3465;class=Strain CX3465]<br>[http://www.wormbase.org/db/get?name=CX3350;class=Strain CX3350] | ||
+ | | I | ||
+ | | [http://www.wormbase.org/db/get?name=Expr296;class=Expr_pattern Expr296] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00005032;class=Gene sra-6] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0004964;class=Anatomy_term SPVL]<br>[http://www.wormbase.org/db/get?name=WBbt:0003887;class=Anatomy_term ASIR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004963;class=Anatomy_term SPVR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004966;class=Anatomy_term SPDL]<br>[http://www.wormbase.org/db/get?name=WBbt:0003889;class=Anatomy_term ASHR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004965;class=Anatomy_term SPDR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004076;class=Anatomy_term PVQL]<br>[http://www.wormbase.org/db/get?name=WBbt:0003890;class=Anatomy_term ASHL]<br>[http://www.wormbase.org/db/get?name=WBbt:0003888;class=Anatomy_term ASIL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004074;class=Anatomy_term PVQR] | ||
+ | | [http://www.wormbase.org/db/get?name=adult%20male;class=Life_stage adult male] | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00002314;class=Paper WBPaper00002314] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=kyIs4;class=Transgene kyIs4] | + | | [http://www.wormbase.org/db/get?name=kyIs4;class=Transgene kyIs4] |
+ | | [ceh-23-unc-76-gfp::lin-15] | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=CX188;class=Strain CX188]<br>[http://www.wormbase.org/db/get?name=CX2565;class=Strain CX2565]<br>[http://www.wormbase.org/db/get?name=CX2993;class=Strain CX2993]<br>[http://www.wormbase.org/db/get?name=CX3125;class=Strain CX3125]<br>[http://www.wormbase.org/db/get?name=CX3137;class=Strain CX3137]<br>[http://www.wormbase.org/db/get?name=CX2627;class=Strain CX2627] | ||
+ | | X | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=kyIs5;class=Transgene kyIs5] | + | | [http://www.wormbase.org/db/get?name=kyIs5;class=Transgene kyIs5] |
+ | | [ceh-23-unc-76-gfp::lin-15] | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=NG2501;class=Strain NG2501]<br>[http://www.wormbase.org/db/get?name=CX2644;class=Strain CX2644] | ||
+ | | IV | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=kyIs53;class=Transgene kyIs53] | + | | [http://www.wormbase.org/db/get?name=kyIs53;class=Transgene kyIs53] |
+ | | [odr-10::gfp]. GFP tagged full length ODR-10. | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=CX3344;class=Strain CX3344] | ||
+ | | X | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=kyIs8;class=Transgene kyIs8] | + | | [http://www.wormbase.org/db/get?name=kyIs8;class=Transgene kyIs8] |
+ | | [ceh-23::gfp, lin-15(+)] | ||
+ | | GFP | ||
+ | | | ||
+ | | I | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=lqIs10;class=Transgene lqIs10] | + | | [http://www.wormbase.org/db/get?name=lqIs10;class=Transgene lqIs10] |
+ | | [ceh-10::gfp, lin-15(+)] | ||
+ | | GFP | ||
+ | | | ||
+ | | X | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=lqIs2;class=Transgene lqIs2] | + | | [http://www.wormbase.org/db/get?name=lqIs2;class=Transgene lqIs2] |
+ | | [osm-6::gfp, lin-15(+)] | ||
+ | | GFP | ||
+ | | | ||
+ | | X | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=lqIs3;class=Transgene lqIs3] | + | | [http://www.wormbase.org/db/get?name=lqIs3;class=Transgene lqIs3] |
+ | | [osm-6::gfp] | ||
+ | | GFP | ||
+ | | | ||
+ | | IV | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=ltIs44;class=Transgene ltIs44] | + | | [http://www.wormbase.org/db/get?name=ltIs44;class=Transgene ltIs44] |
+ | | [pie-1::PHdomain-mCherry] | ||
+ | | mCherry | ||
+ | | [http://www.wormbase.org/db/get?name=DG2160;class=Strain DG2160]<br>[http://www.wormbase.org/db/get?name=DG2189;class=Strain DG2189]<br>[http://www.wormbase.org/db/get?name=OD70;class=Strain OD70] | ||
+ | | V | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=lwIs16;class=Transgene lwIs16] | + | | [http://www.wormbase.org/db/get?name=lwIs16;class=Transgene lwIs16] |
+ | | [act-4::LacZ] | ||
+ | | LacZ | ||
+ | | [http://www.wormbase.org/db/get?name=PJ1077;class=Strain PJ1077]<br>[http://www.wormbase.org/db/get?name=EH16;class=Strain EH16] | ||
+ | | X | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=mIs10;class=Transgene mIs10] | + | | [http://www.wormbase.org/db/get?name=mIs10;class=Transgene mIs10] |
+ | | [myo-2::GFP, pes-10::gfp, F22B7.9::gfp] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=PD4793;class=Strain PD4793]<br>[http://www.wormbase.org/db/get?name=VC148;class=Strain VC148] | ||
+ | | V | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=mIs11;class=Transgene mIs11] | + | | [http://www.wormbase.org/db/get?name=mIs11;class=Transgene mIs11] |
+ | | [myo-2::gfp] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=CA538;class=Strain CA538]<br>[http://www.wormbase.org/db/get?name=HC114;class=Strain HC114]<br>[http://www.wormbase.org/db/get?name=HC271;class=Strain HC271]<br>[http://www.wormbase.org/db/get?name=PD4792;class=Strain PD4792]<br>[http://www.wormbase.org/db/get?name=VC49;class=Strain VC49]<br>[http://www.wormbase.org/db/get?name=VC177;class=Strain VC177]<br>[http://www.wormbase.org/db/get?name=VC485;class=Strain VC485] | ||
+ | | IV:5 | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=mIs12;class=Transgene mIs12] | + | | [http://www.wormbase.org/db/get?name=mIs12;class=Transgene mIs12] |
+ | | [myo-2::GFP, pes-10::GFP, F22B7.9::GFP] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=CB5584;class=Strain CB5584]<br>[http://www.wormbase.org/db/get?name=PD4790;class=Strain PD4790] | ||
+ | | II:1.75 | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=mIs13;class=Transgene mIs13] | + | | [http://www.wormbase.org/db/get?name=mIs13;class=Transgene mIs13] |
+ | | [myo-2::GFP, pes-10::GFP, gut::GFP] expresses GFP under the control of the pharynx-specific myosin-2 (myo-2) promoter, the germline-specific pes-10 promoter as well as a gut specific enhancer. | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=PD4788;class=Strain PD4788]<br>[http://www.wormbase.org/db/get?name=VC129;class=Strain VC129]<br>[http://www.wormbase.org/db/get?name=VC307;class=Strain VC307]<br>[http://www.wormbase.org/db/get?name=VC404;class=Strain VC404] | ||
+ | | I:27.5 | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=mIs14;class=Transgene mIs14] | + | | [http://www.wormbase.org/db/get?name=mIs14;class=Transgene mIs14] |
+ | | [myo-2::gfp; pes-10::gfp] containing the myo-2 and pes-10 promoters and a gut enhancer fused individually to the GFP. | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=AD226;class=Strain AD226]<br>[http://www.wormbase.org/db/get?name=BP601;class=Strain BP601]<br>[http://www.wormbase.org/db/get?name=BP610;class=Strain BP610]<br>[http://www.wormbase.org/db/get?name=BS3493;class=Strain BS3493]<br>[http://www.wormbase.org/db/get?name=DG1612;class=Strain DG1612]<br>[http://www.wormbase.org/db/get?name=DG1650;class=Strain DG1650]<br>[http://www.wormbase.org/db/get?name=DR2078;class=Strain DR2078]<br>[http://www.wormbase.org/db/get?name=DZ205;class=Strain DZ205]<br>[http://www.wormbase.org/db/get?name=DZ240;class=Strain DZ240]<br>[http://www.wormbase.org/db/get?name=GC565;class=Strain GC565]<br>[http://www.wormbase.org/db/get?name=HS458;class=Strain HS458]<br>[http://www.wormbase.org/db/get?name=IC361;class=Strain IC361]<br>[http://www.wormbase.org/db/get?name=JK3107;class=Strain JK3107]<br>[http://www.wormbase.org/db/get?name=JK3172;class=Strain JK3172]<br>[http://www.wormbase.org/db/get?name=JK3182;class=Strain JK3182]<br>[http://www.wormbase.org/db/get?name=JK3345;class=Strain JK3345]<br>[http://www.wormbase.org/db/get?name=JK3375;class=Strain JK3375]<br>[http://www.wormbase.org/db/get?name=JN214;class=Strain JN214]<br>[http://www.wormbase.org/db/get?name=LB21;class=Strain LB21]<br>[http://www.wormbase.org/db/get?name=ML1213;class=Strain ML1213]<br>[http://www.wormbase.org/db/get?name=MT12352;class=Strain MT12352]<br>[http://www.wormbase.org/db/get?name=NG3124;class=Strain NG3124]<br>[http://www.wormbase.org/db/get?name=NG3190;class=Strain NG3190]<br>[http://www.wormbase.org/db/get?name=PS4886;class=Strain PS4886]<br>[http://www.wormbase.org/db/get?name=PS5131;class=Strain PS5131]<br>[http://www.wormbase.org/db/get?name=SA25;class=Strain SA25]<br>[http://www.wormbase.org/db/get?name=SL740;class=Strain SL740]<br>[http://www.wormbase.org/db/get?name=SL940;class=Strain SL940]<br>[http://www.wormbase.org/db/get?name=SL978;class=Strain SL978]<br>[http://www.wormbase.org/db/get?name=SU351;class=Strain SU351]<br>[http://www.wormbase.org/db/get?name=SU352;class=Strain SU352]<br>[http://www.wormbase.org/db/get?name=VC28;class=Strain VC28]<br>[http://www.wormbase.org/db/get?name=VC42;class=Strain VC42]<br>[http://www.wormbase.org/db/get?name=VC114;class=Strain VC114]<br>[http://www.wormbase.org/db/get?name=VC170;class=Strain VC170]<br>[http://www.wormbase.org/db/get?name=VC185;class=Strain VC185]<br>[http://www.wormbase.org/db/get?name=VC206;class=Strain VC206]<br>[http://www.wormbase.org/db/get?name=VC277;class=Strain VC277]<br>[http://www.wormbase.org/db/get?name=VC294;class=Strain VC294]<br>[http://www.wormbase.org/db/get?name=VC308;class=Strain VC308]<br>[http://www.wormbase.org/db/get?name=VC337;class=Strain VC337]<br>[http://www.wormbase.org/db/get?name=VC354;class=Strain VC354]<br>[http://www.wormbase.org/db/get?name=VC363;class=Strain VC363]<br>[http://www.wormbase.org/db/get?name=VC368;class=Strain VC368]<br>[http://www.wormbase.org/db/get?name=VC384;class=Strain VC384]<br>[http://www.wormbase.org/db/get?name=VC389;class=Strain VC389]<br>[http://www.wormbase.org/db/get?name=VC407;class=Strain VC407]<br>[http://www.wormbase.org/db/get?name=VC455;class=Strain VC455]<br>[http://www.wormbase.org/db/get?name=VC465;class=Strain VC465]<br>[http://www.wormbase.org/db/get?name=VC515;class=Strain VC515]<br>[http://www.wormbase.org/db/get?name=VC516;class=Strain VC516]<br>[http://www.wormbase.org/db/get?name=VC536;class=Strain VC536]<br>[http://www.wormbase.org/db/get?name=VC559;class=Strain VC559]<br>[http://www.wormbase.org/db/get?name=VC570;class=Strain VC570]<br>[http://www.wormbase.org/db/get?name=VC572;class=Strain VC572]<br>[http://www.wormbase.org/db/get?name=VC598;class=Strain VC598]<br>[http://www.wormbase.org/db/get?name=VC611;class=Strain VC611]<br>[http://www.wormbase.org/db/get?name=VC663;class=Strain VC663]<br>[http://www.wormbase.org/db/get?name=VC682;class=Strain VC682]<br>[http://www.wormbase.org/db/get?name=VC695;class=Strain VC695]<br>[http://www.wormbase.org/db/get?name=VC703;class=Strain VC703]<br>[http://www.wormbase.org/db/get?name=VC704;class=Strain VC704]<br>[http://www.wormbase.org/db/get?name=VC715;class=Strain VC715]<br>[http://www.wormbase.org/db/get?name=VC724;class=Strain VC724]<br>[http://www.wormbase.org/db/get?name=VC735;class=Strain VC735]<br>[http://www.wormbase.org/db/get?name=VC774;class=Strain VC774]<br>[http://www.wormbase.org/db/get?name=VC777;class=Strain VC777]<br>[http://www.wormbase.org/db/get?name=VC778;class=Strain VC778]<br>[http://www.wormbase.org/db/get?name=VC789;class=Strain VC789]<br>[http://www.wormbase.org/db/get?name=VC842;class=Strain VC842]<br>[http://www.wormbase.org/db/get?name=VC895;class=Strain VC895]<br>[http://www.wormbase.org/db/get?name=VC898;class=Strain VC898]<br>[http://www.wormbase.org/db/get?name=VC902;class=Strain VC902]<br>[http://www.wormbase.org/db/get?name=VC926;class=Strain VC926]<br>[http://www.wormbase.org/db/get?name=VC946;class=Strain VC946]<br>[http://www.wormbase.org/db/get?name=VC965;class=Strain VC965]<br>[http://www.wormbase.org/db/get?name=VC984;class=Strain VC984]<br>[http://www.wormbase.org/db/get?name=VC1016;class=Strain VC1016]<br>[http://www.wormbase.org/db/get?name=VC1033;class=Strain VC1033]<br>[http://www.wormbase.org/db/get?name=VC1049;class=Strain VC1049]<br>[http://www.wormbase.org/db/get?name=VC1082;class=Strain VC1082]<br>[http://www.wormbase.org/db/get?name=VC1112;class=Strain VC1112]<br>[http://www.wormbase.org/db/get?name=VC1123;class=Strain VC1123]<br>[http://www.wormbase.org/db/get?name=VC1135;class=Strain VC1135]<br>[http://www.wormbase.org/db/get?name=VC1158;class=Strain VC1158]<br>[http://www.wormbase.org/db/get?name=VC1165;class=Strain VC1165]<br>[http://www.wormbase.org/db/get?name=VC1274;class=Strain VC1274]<br>[http://www.wormbase.org/db/get?name=VC1275;class=Strain VC1275]<br>[http://www.wormbase.org/db/get?name=VC1300;class=Strain VC1300]<br>[http://www.wormbase.org/db/get?name=VC1330;class=Strain VC1330]<br>[http://www.wormbase.org/db/get?name=VC1333;class=Strain VC1333]<br>[http://www.wormbase.org/db/get?name=VC1336;class=Strain VC1336]<br>[http://www.wormbase.org/db/get?name=VC1345;class=Strain VC1345]<br>[http://www.wormbase.org/db/get?name=VC1368;class=Strain VC1368]<br>[http://www.wormbase.org/db/get?name=VC1401;class=Strain VC1401]<br>[http://www.wormbase.org/db/get?name=VC1424;class=Strain VC1424]<br>[http://www.wormbase.org/db/get?name=VC1426;class=Strain VC1426]<br>[http://www.wormbase.org/db/get?name=VC1438;class=Strain VC1438]<br>[http://www.wormbase.org/db/get?name=VC1458;class=Strain VC1458]<br>[http://www.wormbase.org/db/get?name=VC1474;class=Strain VC1474]<br>[http://www.wormbase.org/db/get?name=VC1498;class=Strain VC1498]<br>[http://www.wormbase.org/db/get?name=VC1505;class=Strain VC1505]<br>[http://www.wormbase.org/db/get?name=VC1506;class=Strain VC1506]<br>[http://www.wormbase.org/db/get?name=VC1636;class=Strain VC1636]<br>[http://www.wormbase.org/db/get?name=VC1710;class=Strain VC1710]<br>[http://www.wormbase.org/db/get?name=VC1781;class=Strain VC1781]<br>[http://www.wormbase.org/db/get?name=VC1783;class=Strain VC1783]<br>[http://www.wormbase.org/db/get?name=VC1790;class=Strain VC1790]<br>[http://www.wormbase.org/db/get?name=VC1794;class=Strain VC1794]<br>[http://www.wormbase.org/db/get?name=VC1832;class=Strain VC1832]<br>[http://www.wormbase.org/db/get?name=VC1834;class=Strain VC1834]<br>[http://www.wormbase.org/db/get?name=VC1887;class=Strain VC1887]<br>[http://www.wormbase.org/db/get?name=VC1888;class=Strain VC1888]<br>[http://www.wormbase.org/db/get?name=VC1914;class=Strain VC1914]<br>[http://www.wormbase.org/db/get?name=VC1998;class=Strain VC1998]<br>[http://www.wormbase.org/db/get?name=VC2013;class=Strain VC2013]<br>[http://www.wormbase.org/db/get?name=VC2033;class=Strain VC2033]<br>[http://www.wormbase.org/db/get?name=VC2091;class=Strain VC2091]<br>[http://www.wormbase.org/db/get?name=VC10002;class=Strain VC10002]<br>[http://www.wormbase.org/db/get?name=VC10005;class=Strain VC10005]<br>[http://www.wormbase.org/db/get?name=VC10007;class=Strain VC10007] | ||
+ | | II | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=mIs6;class=Transgene mIs6] | + | | [http://www.wormbase.org/db/get?name=mIs6;class=Transgene mIs6] |
+ | | [daf-7::gfp, rol-6(su1006)] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=DR1808;class=Strain DR1808] | ||
+ | | X | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=maIs103;class=Transgene maIs103] | + | | [http://www.wormbase.org/db/get?name=maIs103;class=Transgene maIs103] |
+ | | [rnr::gfp] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=SV273;class=Strain SV273]<br>[http://www.wormbase.org/db/get?name=SV275;class=Strain SV275]<br>[http://www.wormbase.org/db/get?name=SV411;class=Strain SV411]<br>[http://www.wormbase.org/db/get?name=VT765;class=Strain VT765]<br>[http://www.wormbase.org/db/get?name=VT774;class=Strain VT774] | ||
+ | | X | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=mcIs11;class=Transgene mcIs11] | + | | [http://www.wormbase.org/db/get?name=mcIs11;class=Transgene mcIs11] |
+ | | [lin-26(+)]. Integrated expression line for lin-26 promoter deletion construct | ||
+ | | | ||
+ | | | ||
+ | | III | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=mcIs14;class=Transgene mcIs14] | + | | [http://www.wormbase.org/db/get?name=mcIs14;class=Transgene mcIs14] |
+ | | [lin-26(+)]. Integrated expression line for lin-26 promoter deletion construct. | ||
+ | | | ||
+ | | | ||
+ | | IV | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=mgIs18;class=Transgene mgIs18] | + | | [http://www.wormbase.org/db/get?name=mgIs18;class=Transgene mgIs18] |
+ | | [ttx-3::gfp] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=OH99;class=Strain OH99]<br>[http://www.wormbase.org/db/get?name=OH160;class=Strain OH160]<br>[http://www.wormbase.org/db/get?name=OH912;class=Strain OH912]<br>[http://www.wormbase.org/db/get?name=OH2018;class=Strain OH2018] | ||
+ | | IV | ||
+ | | [http://www.wormbase.org/db/get?name=Expr1352;class=Expr_pattern Expr1352] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00006654;class=Gene ttx-3] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0003995;class=Anatomy_term ADLR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003887;class=Anatomy_term ASIR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003997;class=Anatomy_term ADLL]<br>[http://www.wormbase.org/db/get?name=WBbt:0005439;class=Anatomy_term pharyngeal neuron]<br>[http://www.wormbase.org/db/get?name=WBbt:0003963;class=Anatomy_term AIYL]<br>[http://www.wormbase.org/db/get?name=WBbt:0003987;class=Anatomy_term AIAR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003989;class=Anatomy_term AIAL]<br>[http://www.wormbase.org/db/get?name=WBbt:0003961;class=Anatomy_term AIYR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003888;class=Anatomy_term ASIL] | ||
+ | | [http://www.wormbase.org/db/get?name=postembryonic;class=Life_stage postembryonic] | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00004727;class=Paper WBPaper00004727] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=mgIs32;class=Transgene mgIs32] | + | | [http://www.wormbase.org/db/get?name=mgIs32;class=Transgene mgIs32] |
+ | | [ttx-3::gfp; lin-15(+)] | ||
+ | | GFP | ||
+ | | | ||
+ | | III | ||
+ | | [http://www.wormbase.org/db/get?name=Expr1352;class=Expr_pattern Expr1352] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00006654;class=Gene ttx-3] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0003995;class=Anatomy_term ADLR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003887;class=Anatomy_term ASIR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003997;class=Anatomy_term ADLL]<br>[http://www.wormbase.org/db/get?name=WBbt:0005439;class=Anatomy_term pharyngeal neuron]<br>[http://www.wormbase.org/db/get?name=WBbt:0003963;class=Anatomy_term AIYL]<br>[http://www.wormbase.org/db/get?name=WBbt:0003987;class=Anatomy_term AIAR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003989;class=Anatomy_term AIAL]<br>[http://www.wormbase.org/db/get?name=WBbt:0003961;class=Anatomy_term AIYR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003888;class=Anatomy_term ASIL] | ||
+ | | [http://www.wormbase.org/db/get?name=postembryonic;class=Life_stage postembryonic] | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00004727;class=Paper WBPaper00004727] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=mgIs45;class=Transgene mgIs45] | + | | [http://www.wormbase.org/db/get?name=mgIs45;class=Transgene mgIs45] |
+ | | [mir-84(+); tub-1::gfp] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=GR1426;class=Strain GR1426]<br>[http://www.wormbase.org/db/get?name=GR1428;class=Strain GR1428]<br>[http://www.wormbase.org/db/get?name=GR1446;class=Strain GR1446]<br>[http://www.wormbase.org/db/get?name=GR1447;class=Strain GR1447] | ||
+ | | I | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=mgIs49;class=Transgene mgIs49] | + | | [http://www.wormbase.org/db/get?name=mgIs49;class=Transgene mgIs49] |
+ | | [mlt-10::gfp-pest; ttx-3::gfp] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=GR1395;class=Strain GR1395]<br>[http://www.wormbase.org/db/get?name=GR1436;class=Strain GR1436]<br>[http://www.wormbase.org/db/get?name=GR1437;class=Strain GR1437]<br>[http://www.wormbase.org/db/get?name=GR1438;class=Strain GR1438] | ||
+ | | IV | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=mnIs17;class=Transgene mnIs17] | + | | [http://www.wormbase.org/db/get?name=mnIs17;class=Transgene mnIs17] |
+ | | [osm-6::gfp; unc-36(+)] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=SP2101;class=Strain SP2101] | ||
+ | | V | ||
+ | | [http://www.wormbase.org/db/get?name=Expr507;class=Expr_pattern Expr507] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00003886;class=Gene osm-6] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0004007;class=Anatomy_term ADER]<br>[http://www.wormbase.org/db/get?name=WBbt:0003995;class=Anatomy_term ADLR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004737;class=Anatomy_term IL1DR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004445;class=Anatomy_term OLLL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004541;class=Anatomy_term IL2L]<br>[http://www.wormbase.org/db/get?name=WBbt:0003887;class=Anatomy_term ASIR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004096;class=Anatomy_term PQR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004547;class=Anatomy_term IL1VR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004365;class=Anatomy_term PHAR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003828;class=Anatomy_term AWBR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004931;class=Anatomy_term CEPVR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003997;class=Anatomy_term ADLL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004431;class=Anatomy_term OLQVR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003892;class=Anatomy_term ASGL]<br>[http://www.wormbase.org/db/get?name=WBbt:0003831;class=Anatomy_term AWAL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004009;class=Anatomy_term ADEL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004543;class=Anatomy_term IL2DR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003884;class=Anatomy_term ASKL]<br>[http://www.wormbase.org/db/get?name=WBbt:0003826;class=Anatomy_term AWCR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004439;class=Anatomy_term OLQDL]<br>[http://www.wormbase.org/db/get?name=WBbt:0003886;class=Anatomy_term ASJL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004939;class=Anatomy_term CEMVR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003927;class=Anatomy_term AQR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004738;class=Anatomy_term IL1DL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004003;class=Anatomy_term ADFL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004437;class=Anatomy_term OLQVL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004941;class=Anatomy_term CEMVL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004549;class=Anatomy_term IL1VL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004537;class=Anatomy_term IL2VR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003889;class=Anatomy_term ASHR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003904;class=Anatomy_term ASEL]<br>[http://www.wormbase.org/db/get?name=WBbt:0003827;class=Anatomy_term AWCL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004945;class=Anatomy_term CEMDL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004551;class=Anatomy_term IL1R]<br>[http://www.wormbase.org/db/get?name=WBbt:0004366;class=Anatomy_term PHAL]<br>[http://www.wormbase.org/db/get?name=WBbt:0003993;class=Anatomy_term AFDL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004937;class=Anatomy_term CEPDR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004539;class=Anatomy_term IL2R]<br>[http://www.wormbase.org/db/get?name=WBbt:0005659;class=Anatomy_term PHBR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004444;class=Anatomy_term OLLR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003991;class=Anatomy_term AFDR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003891;class=Anatomy_term ASGR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003883;class=Anatomy_term ASKR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004364;class=Anatomy_term PHBL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004933;class=Anatomy_term CEPVL]<br>[http://www.wormbase.org/db/get?name=WBbt:0003885;class=Anatomy_term ASJR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004545;class=Anatomy_term IL2DL]<br>[http://www.wormbase.org/db/get?name=WBbt:0003999;class=Anatomy_term ADFR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004943;class=Anatomy_term CEMDR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003890;class=Anatomy_term ASHL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004383;class=Anatomy_term PDEL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004938;class=Anatomy_term CEPDL]<br>[http://www.wormbase.org/db/get?name=WBbt:0003830;class=Anatomy_term AWAR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004438;class=Anatomy_term OLQDR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003888;class=Anatomy_term ASIL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004538;class=Anatomy_term IL2VL]<br>[http://www.wormbase.org/db/get?name=WBbt:0003829;class=Anatomy_term AWBL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004553;class=Anatomy_term IL1L]<br>[http://www.wormbase.org/db/get?name=WBbt:0003903;class=Anatomy_term ASER]<br>[http://www.wormbase.org/db/get?name=WBbt:0005246;class=Anatomy_term CEM]<br>[http://www.wormbase.org/db/get?name=WBbt:0004382;class=Anatomy_term PDER] | ||
+ | | [http://www.wormbase.org/db/get?name=adult;class=Life_stage adult]<br>[http://www.wormbase.org/db/get?name=L1%20larva;class=Life_stage L1 larva]<br>[http://www.wormbase.org/db/get?name=L2%20larva;class=Life_stage L2 larva]<br>[http://www.wormbase.org/db/get?name=L3%20larva;class=Life_stage L3 larva]<br>[http://www.wormbase.org/db/get?name=L4%20larva;class=Life_stage L4 larva]<br>[http://www.wormbase.org/db/get?name=fully-elongated%20embryo;class=Life_stage fully-elongated embryo] | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00002980;class=Paper WBPaper00002980] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=mnIs17;class=Transgene mnIs17] | + | | [http://www.wormbase.org/db/get?name=mnIs17;class=Transgene mnIs17] |
+ | | [osm-6::gfp; unc-36(+)] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=SP2101;class=Strain SP2101] | ||
+ | | V | ||
+ | | [http://www.wormbase.org/db/get?name=Marker73;class=Expr_pattern Marker73] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00003886;class=Gene osm-6] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0005394;class=Anatomy_term amphid neuron]<br>[http://www.wormbase.org/db/get?name=WBbt:0006753;class=Anatomy_term phasmid neuron] | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00031375;class=Paper WBPaper00031375] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=mnIs7;class=Transgene mnIs7] | + | | [http://www.wormbase.org/db/get?name=mnIs7;class=Transgene mnIs7] |
+ | | [lin-44::gfp; unc-29(+)] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=SP1914;class=Strain SP1914] | ||
+ | | X | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=muIs10;class=Transgene muIs10] | + | | [http://www.wormbase.org/db/get?name=muIs10;class=Transgene muIs10] |
+ | | [hsp-16.1::mab-5; C14G10(unc-31+)] | ||
+ | | | ||
+ | | | ||
+ | | X | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=muIs102;class=Transgene muIs102] | + | | [http://www.wormbase.org/db/get?name=muIs102;class=Transgene muIs102] |
+ | | [gcy-32::gfp] | ||
+ | | GFP | ||
+ | | | ||
+ | | V | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=muIs109;class=Transgene muIs109] | + | | [http://www.wormbase.org/db/get?name=muIs109;class=Transgene muIs109] |
+ | | [daf-16::gfp::daf-16; odr-1::rfp] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=CF1935;class=Strain CF1935]<br>[http://www.wormbase.org/db/get?name=CF2135;class=Strain CF2135] | ||
+ | | X | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=muIs13;class=Transgene muIs13] | + | | [http://www.wormbase.org/db/get?name=muIs13;class=Transgene muIs13] |
+ | | [egl-5::lacZ] | ||
+ | | LacZ | ||
+ | | [http://www.wormbase.org/db/get?name=CF391;class=Strain CF391] | ||
+ | | V | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=muIs16;class=Transgene muIs16] | + | | [http://www.wormbase.org/db/get?name=muIs16;class=Transgene muIs16] |
+ | | [mab-5::gfp] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=CF453;class=Strain CF453]<br>[http://www.wormbase.org/db/get?name=HZ111;class=Strain HZ111]<br>[http://www.wormbase.org/db/get?name=HZ112;class=Strain HZ112] | ||
+ | | II | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=muIs2;class=Transgene muIs2] | + | | [http://www.wormbase.org/db/get?name=muIs2;class=Transgene muIs2] |
+ | | [mab-5::lacZ; unc-31(+)], contained 7 kb upstream of mab-5 and the first 17 amino acids of coding sequence. Transgenic markers: Unc-31 | ||
+ | | LacZ | ||
+ | | [http://www.wormbase.org/db/get?name=CF237;class=Strain CF237]<br>[http://www.wormbase.org/db/get?name=CF186;class=Strain CF186]<br>[http://www.wormbase.org/db/get?name=CF180;class=Strain CF180]<br>[http://www.wormbase.org/db/get?name=CF190;class=Strain CF190]<br>[http://www.wormbase.org/db/get?name=CF182;class=Strain CF182] | ||
+ | | IV | ||
+ | | [http://www.wormbase.org/db/get?name=Expr585;class=Expr_pattern Expr585] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00003102;class=Gene mab-5] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0005919;class=Anatomy_term ABplppppap]<br>[http://www.wormbase.org/db/get?name=WBbt:0004898;class=Anatomy_term V3L]<br>[http://www.wormbase.org/db/get?name=WBbt:0006775;class=Anatomy_term P6]<br>[http://www.wormbase.org/db/get?name=WBbt:0006352;class=Anatomy_term ABplppppa]<br>[http://www.wormbase.org/db/get?name=WBbt:0004765;class=Anatomy_term H1R]<br>[http://www.wormbase.org/db/get?name=WBbt:0004876;class=Anatomy_term V5R]<br>[http://www.wormbase.org/db/get?name=WBbt:0006777;class=Anatomy_term P8]<br>[http://www.wormbase.org/db/get?name=WBbt:0005733;class=Anatomy_term hypodermis]<br>[http://www.wormbase.org/db/get?name=WBbt:0004874;class=Anatomy_term V6R]<br>[http://www.wormbase.org/db/get?name=WBbt:0006109;class=Anatomy_term ABplppppaa]<br>[http://www.wormbase.org/db/get?name=WBbt:0006055;class=Anatomy_term ABprppppa]<br>[http://www.wormbase.org/db/get?name=WBbt:0004905;class=Anatomy_term V1L]<br>[http://www.wormbase.org/db/get?name=WBbt:0004410;class=Anatomy_term P11]<br>[http://www.wormbase.org/db/get?name=WBbt:0006770;class=Anatomy_term P1]<br>[http://www.wormbase.org/db/get?name=WBbt:0005960;class=Anatomy_term ABplpppppp]<br>[http://www.wormbase.org/db/get?name=WBbt:0006779;class=Anatomy_term P10]<br>[http://www.wormbase.org/db/get?name=WBbt:0006642;class=Anatomy_term ABprppppaa]<br>[http://www.wormbase.org/db/get?name=WBbt:0006772;class=Anatomy_term P3]<br>[http://www.wormbase.org/db/get?name=WBbt:0004766;class=Anatomy_term H1L]<br>[http://www.wormbase.org/db/get?name=WBbt:0005983;class=Anatomy_term ABprppppp]<br>[http://www.wormbase.org/db/get?name=WBbt:0004944;class=Anatomy_term TR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004875;class=Anatomy_term V6L]<br>[http://www.wormbase.org/db/get?name=WBbt:0004946;class=Anatomy_term TL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004890;class=Anatomy_term V5L]<br>[http://www.wormbase.org/db/get?name=WBbt:0006774;class=Anatomy_term P5]<br>[http://www.wormbase.org/db/get?name=WBbt:0006343;class=Anatomy_term ABplpppppa]<br>[http://www.wormbase.org/db/get?name=WBbt:0004764;class=Anatomy_term H2L]<br>[http://www.wormbase.org/db/get?name=WBbt:0004763;class=Anatomy_term H2R]<br>[http://www.wormbase.org/db/get?name=WBbt:0004904;class=Anatomy_term V1R]<br>[http://www.wormbase.org/db/get?name=WBbt:0006776;class=Anatomy_term P7]<br>[http://www.wormbase.org/db/get?name=WBbt:0006771;class=Anatomy_term P2]<br>[http://www.wormbase.org/db/get?name=WBbt:0006439;class=Anatomy_term ABprppppap]<br>[http://www.wormbase.org/db/get?name=WBbt:0004892;class=Anatomy_term V4R]<br>[http://www.wormbase.org/db/get?name=WBbt:0004902;class=Anatomy_term V2L]<br>[http://www.wormbase.org/db/get?name=WBbt:0004409;class=Anatomy_term P12]<br>[http://www.wormbase.org/db/get?name=WBbt:0006778;class=Anatomy_term P9]<br>[http://www.wormbase.org/db/get?name=WBbt:0006574;class=Anatomy_term ABplppppp]<br>[http://www.wormbase.org/db/get?name=WBbt:0004894;class=Anatomy_term V4L]<br>[http://www.wormbase.org/db/get?name=WBbt:0006430;class=Anatomy_term ABprpppppp]<br>[http://www.wormbase.org/db/get?name=WBbt:0006773;class=Anatomy_term P4]<br>[http://www.wormbase.org/db/get?name=WBbt:0004900;class=Anatomy_term V2R]<br>[http://www.wormbase.org/db/get?name=WBbt:0006663;class=Anatomy_term ABprpppppa]<br>[http://www.wormbase.org/db/get?name=WBbt:0004896;class=Anatomy_term V3R] | ||
+ | | [http://www.wormbase.org/db/get?name=1.5-fold%20embryo;class=Life_stage 1.5-fold embryo]<br>[http://www.wormbase.org/db/get?name=L1%20larva;class=Life_stage L1 larva]<br>[http://www.wormbase.org/db/get?name=gastrulating%20embryo;class=Life_stage gastrulating embryo]<br>[http://www.wormbase.org/db/get?name=enclosing%20embryo;class=Life_stage enclosing embryo] | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00001639;class=Paper WBPaper00001639] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=muIs3;class=Transgene muIs3] | + | | [http://www.wormbase.org/db/get?name=muIs3;class=Transgene muIs3] |
+ | | [mab-5::lacZ; unc-31(+)], contained 7 kb upstream of mab-5 and the first 17 amino acids of coding sequence. Transgenic markers: rol-6(su1006). | ||
+ | | LacZ | ||
+ | | [http://www.wormbase.org/db/get?name=CF196;class=Strain CF196]<br>[http://www.wormbase.org/db/get?name=CF236;class=Strain CF236] | ||
+ | | V | ||
+ | | [http://www.wormbase.org/db/get?name=Expr585;class=Expr_pattern Expr585] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00003102;class=Gene mab-5] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0005919;class=Anatomy_term ABplppppap]<br>[http://www.wormbase.org/db/get?name=WBbt:0004898;class=Anatomy_term V3L]<br>[http://www.wormbase.org/db/get?name=WBbt:0006775;class=Anatomy_term P6]<br>[http://www.wormbase.org/db/get?name=WBbt:0006352;class=Anatomy_term ABplppppa]<br>[http://www.wormbase.org/db/get?name=WBbt:0004765;class=Anatomy_term H1R]<br>[http://www.wormbase.org/db/get?name=WBbt:0004876;class=Anatomy_term V5R]<br>[http://www.wormbase.org/db/get?name=WBbt:0006777;class=Anatomy_term P8]<br>[http://www.wormbase.org/db/get?name=WBbt:0005733;class=Anatomy_term hypodermis]<br>[http://www.wormbase.org/db/get?name=WBbt:0004874;class=Anatomy_term V6R]<br>[http://www.wormbase.org/db/get?name=WBbt:0006109;class=Anatomy_term ABplppppaa]<br>[http://www.wormbase.org/db/get?name=WBbt:0006055;class=Anatomy_term ABprppppa]<br>[http://www.wormbase.org/db/get?name=WBbt:0004905;class=Anatomy_term V1L]<br>[http://www.wormbase.org/db/get?name=WBbt:0004410;class=Anatomy_term P11]<br>[http://www.wormbase.org/db/get?name=WBbt:0006770;class=Anatomy_term P1]<br>[http://www.wormbase.org/db/get?name=WBbt:0005960;class=Anatomy_term ABplpppppp]<br>[http://www.wormbase.org/db/get?name=WBbt:0006779;class=Anatomy_term P10]<br>[http://www.wormbase.org/db/get?name=WBbt:0006642;class=Anatomy_term ABprppppaa]<br>[http://www.wormbase.org/db/get?name=WBbt:0006772;class=Anatomy_term P3]<br>[http://www.wormbase.org/db/get?name=WBbt:0004766;class=Anatomy_term H1L]<br>[http://www.wormbase.org/db/get?name=WBbt:0005983;class=Anatomy_term ABprppppp]<br>[http://www.wormbase.org/db/get?name=WBbt:0004944;class=Anatomy_term TR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004875;class=Anatomy_term V6L]<br>[http://www.wormbase.org/db/get?name=WBbt:0004946;class=Anatomy_term TL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004890;class=Anatomy_term V5L]<br>[http://www.wormbase.org/db/get?name=WBbt:0006774;class=Anatomy_term P5]<br>[http://www.wormbase.org/db/get?name=WBbt:0006343;class=Anatomy_term ABplpppppa]<br>[http://www.wormbase.org/db/get?name=WBbt:0004764;class=Anatomy_term H2L]<br>[http://www.wormbase.org/db/get?name=WBbt:0004763;class=Anatomy_term H2R]<br>[http://www.wormbase.org/db/get?name=WBbt:0004904;class=Anatomy_term V1R]<br>[http://www.wormbase.org/db/get?name=WBbt:0006776;class=Anatomy_term P7]<br>[http://www.wormbase.org/db/get?name=WBbt:0006771;class=Anatomy_term P2]<br>[http://www.wormbase.org/db/get?name=WBbt:0006439;class=Anatomy_term ABprppppap]<br>[http://www.wormbase.org/db/get?name=WBbt:0004892;class=Anatomy_term V4R]<br>[http://www.wormbase.org/db/get?name=WBbt:0004902;class=Anatomy_term V2L]<br>[http://www.wormbase.org/db/get?name=WBbt:0004409;class=Anatomy_term P12]<br>[http://www.wormbase.org/db/get?name=WBbt:0006778;class=Anatomy_term P9]<br>[http://www.wormbase.org/db/get?name=WBbt:0006574;class=Anatomy_term ABplppppp]<br>[http://www.wormbase.org/db/get?name=WBbt:0004894;class=Anatomy_term V4L]<br>[http://www.wormbase.org/db/get?name=WBbt:0006430;class=Anatomy_term ABprpppppp]<br>[http://www.wormbase.org/db/get?name=WBbt:0006773;class=Anatomy_term P4]<br>[http://www.wormbase.org/db/get?name=WBbt:0004900;class=Anatomy_term V2R]<br>[http://www.wormbase.org/db/get?name=WBbt:0006663;class=Anatomy_term ABprpppppa]<br>[http://www.wormbase.org/db/get?name=WBbt:0004896;class=Anatomy_term V3R] | ||
+ | | [http://www.wormbase.org/db/get?name=1.5-fold%20embryo;class=Life_stage 1.5-fold embryo]<br>[http://www.wormbase.org/db/get?name=L1%20larva;class=Life_stage L1 larva]<br>[http://www.wormbase.org/db/get?name=gastrulating%20embryo;class=Life_stage gastrulating embryo]<br>[http://www.wormbase.org/db/get?name=enclosing%20embryo;class=Life_stage enclosing embryo] | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00001639;class=Paper WBPaper00001639] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=muIs32;class=Transgene muIs32] | + | | [http://www.wormbase.org/db/get?name=muIs32;class=Transgene muIs32] |
+ | | [mec-7::GFP] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=CF1665;class=Strain CF1665]<br>[http://www.wormbase.org/db/get?name=CF1756;class=Strain CF1756]<br>[http://www.wormbase.org/db/get?name=KN369;class=Strain KN369]<br>[http://www.wormbase.org/db/get?name=KN387;class=Strain KN387]<br>[http://www.wormbase.org/db/get?name=KN562;class=Strain KN562]<br>[http://www.wormbase.org/db/get?name=NW1701;class=Strain NW1701] | ||
+ | | II | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=muIs35;class=Transgene muIs35] | + | | [http://www.wormbase.org/db/get?name=muIs35;class=Transgene muIs35] |
+ | | [mec-7::gfp; lin-15(+)] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=CF1192;class=Strain CF1192]<br>[http://www.wormbase.org/db/get?name=CF1632;class=Strain CF1632]<br>[http://www.wormbase.org/db/get?name=CF703;class=Strain CF703] | ||
+ | | V | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=muIs4;class=Transgene muIs4] | + | | [http://www.wormbase.org/db/get?name=muIs4;class=Transgene muIs4] |
+ | | [mab-5::lacZ, rol-6(d)] | ||
+ | | LacZ | ||
+ | | | ||
+ | | I | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=muIs49;class=Transgene muIs49] | + | | [http://www.wormbase.org/db/get?name=muIs49;class=Transgene muIs49] |
+ | | [egl-20::gfp; unc-22 antisense]. Rescuing egl-20::gfp translational fusion | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=CF1045;class=Strain CF1045] | ||
+ | | V | ||
+ | | [http://www.wormbase.org/db/get?name=Expr989;class=Expr_pattern Expr989] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00001188;class=Gene egl-20] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0003675;class=Anatomy_term muscle cell] | ||
+ | | [http://www.wormbase.org/db/get?name=embryo;class=Life_stage embryo]<br>[http://www.wormbase.org/db/get?name=L1%20larva;class=Life_stage L1 larva] | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00003818;class=Paper WBPaper00003818] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=muIs49;class=Transgene muIs49] | + | | [http://www.wormbase.org/db/get?name=muIs49;class=Transgene muIs49] |
+ | | [egl-20::gfp; unc-22 antisense]. Rescuing egl-20::gfp translational fusion | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=CF1045;class=Strain CF1045] | ||
+ | | V | ||
+ | | [http://www.wormbase.org/db/get?name=Expr3846;class=Expr_pattern Expr3846] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00001188;class=Gene egl-20] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0005733;class=Anatomy_term hypodermis]<br>[http://www.wormbase.org/db/get?name=WBbt:0003675;class=Anatomy_term muscle cell] | ||
+ | | [http://www.wormbase.org/db/get?name=elongating%20embryo;class=Life_stage elongating embryo]<br>[http://www.wormbase.org/db/get?name=fully-elongated%20embryo;class=Life_stage fully-elongated embryo]<br>[http://www.wormbase.org/db/get?name=L1%20larva;class=Life_stage L1 larva]<br>[http://www.wormbase.org/db/get?name=L2%20larva;class=Life_stage L2 larva]<br>[http://www.wormbase.org/db/get?name=L3%20larva;class=Life_stage L3 larva]<br>[http://www.wormbase.org/db/get?name=L4%20larva;class=Life_stage L4 larva] | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00027140;class=Paper WBPaper00027140] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=muIs49;class=Transgene muIs49] | + | | [http://www.wormbase.org/db/get?name=muIs49;class=Transgene muIs49] |
+ | | [egl-20::gfp; unc-22 antisense]. Rescuing egl-20::gfp translational fusion | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=CF1045;class=Strain CF1045] | ||
+ | | V | ||
+ | | [http://www.wormbase.org/db/get?name=Expr3848;class=Expr_pattern Expr3848] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00001188;class=Gene egl-20] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0005733;class=Anatomy_term hypodermis]<br>[http://www.wormbase.org/db/get?name=WBbt:0003675;class=Anatomy_term muscle cell] | ||
+ | | [http://www.wormbase.org/db/get?name=comma%20embryo;class=Life_stage comma embryo]<br>[http://www.wormbase.org/db/get?name=1.5-fold%20embryo;class=Life_stage 1.5-fold embryo]<br>[http://www.wormbase.org/db/get?name=2-fold%20embryo;class=Life_stage 2-fold embryo]<br>[http://www.wormbase.org/db/get?name=3-fold%20embryo;class=Life_stage 3-fold embryo]<br>[http://www.wormbase.org/db/get?name=L1%20larva;class=Life_stage L1 larva]<br>[http://www.wormbase.org/db/get?name=L2%20larva;class=Life_stage L2 larva]<br>[http://www.wormbase.org/db/get?name=L3%20larva;class=Life_stage L3 larva]<br>[http://www.wormbase.org/db/get?name=L4%20larva;class=Life_stage L4 larva] | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00027140;class=Paper WBPaper00027140] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=muIs5;class=Transgene muIs5] | + | | [http://www.wormbase.org/db/get?name=muIs5;class=Transgene muIs5] |
+ | | [lin-39::lacZ] | ||
+ | | LacZ | ||
+ | | | ||
+ | | X | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=muIs6;class=Transgene muIs6] | + | | [http://www.wormbase.org/db/get?name=muIs6;class=Transgene muIs6] |
+ | | [lin-39::lacZ] | ||
+ | | LacZ | ||
+ | | [http://www.wormbase.org/db/get?name=CF267;class=Strain CF267] | ||
+ | | IV | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=muIs71;class=Transgene muIs71] | + | | [http://www.wormbase.org/db/get?name=muIs71;class=Transgene muIs71] |
+ | | [daf-16a::gfp/bKO]. A frameshift mutation was introduced into the DAF-16b-specific exon upstream of the winged-helix domain by digestion with NgoMIV followed by `fill-in' and re-ligation of DAF-16a::GFP to generate DAF-16a::GFP/bKO. | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=CF1407;class=Strain CF1407] | ||
+ | | X | ||
+ | | [http://www.wormbase.org/db/get?name=Expr3117;class=Expr_pattern Expr3117] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00000912;class=Gene daf-16] | ||
+ | | | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00024399;class=Paper WBPaper00024399] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=muIs71;class=Transgene muIs71] | + | | [http://www.wormbase.org/db/get?name=muIs71;class=Transgene muIs71] |
+ | | [daf-16a::gfp/bKO]. A frameshift mutation was introduced into the DAF-16b-specific exon upstream of the winged-helix domain by digestion with NgoMIV followed by `fill-in' and re-ligation of DAF-16a::GFP to generate DAF-16a::GFP/bKO. | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=CF1407;class=Strain CF1407] | ||
+ | | X | ||
+ | | [http://www.wormbase.org/db/get?name=Expr3860;class=Expr_pattern Expr3860] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00000912;class=Gene daf-16] | ||
+ | | | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00027074;class=Paper WBPaper00027074] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=muIs9;class=Transgene muIs9] | + | | [http://www.wormbase.org/db/get?name=muIs9;class=Transgene muIs9] |
+ | | [hs::mab-5; C14G10(unc-31+)] | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=CF301;class=Strain CF301]<br>[http://www.wormbase.org/db/get?name=CF303;class=Strain CF303] | ||
+ | | X | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=mxIs14;class=Transgene mxIs14] | + | | [http://www.wormbase.org/db/get?name=mxIs14;class=Transgene mxIs14] |
+ | | [egl-1::histone-gfp] transcariptional fusion. | ||
+ | | GFP | ||
+ | | | ||
+ | | X | ||
+ | | [http://www.wormbase.org/db/get?name=Expr3857;class=Expr_pattern Expr3857] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00001170;class=Gene egl-1] | ||
+ | | | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00027049;class=Paper WBPaper00027049] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=myIs1;class=Transgene myIs1] | + | | [http://www.wormbase.org/db/get?name=myIs1;class=Transgene myIs1] |
+ | | [pkd-2::gfp] | ||
+ | | GFP | ||
+ | | | ||
+ | | IV | ||
+ | | [http://www.wormbase.org/db/get?name=Expr7822;class=Expr_pattern Expr7822] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00004035;class=Gene pkd-2] | ||
+ | | | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00031243;class=Paper WBPaper00031243] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=myIs4;class=Transgene myIs4] | + | | [http://www.wormbase.org/db/get?name=myIs4;class=Transgene myIs4] |
+ | | [pkd-2::gfp; cc::gfp] | ||
+ | | GFP | ||
+ | | | ||
+ | | V | ||
+ | | [http://www.wormbase.org/db/get?name=Expr4254;class=Expr_pattern Expr4254] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00004035;class=Gene pkd-2] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0004033;class=Anatomy_term R3BR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004000;class=Anatomy_term R7BR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004027;class=Anatomy_term R4BR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004040;class=Anatomy_term R2BL]<br>[http://www.wormbase.org/db/get?name=WBbt:0003988;class=Anatomy_term R8BR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004939;class=Anatomy_term CEMVR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004761;class=Anatomy_term HOB]<br>[http://www.wormbase.org/db/get?name=WBbt:0004941;class=Anatomy_term CEMVL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004021;class=Anatomy_term R5BR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004039;class=Anatomy_term R2BR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004028;class=Anatomy_term R4BL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004034;class=Anatomy_term R3BL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004945;class=Anatomy_term CEMDL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004046;class=Anatomy_term R1BR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003968;class=Anatomy_term R9BL]<br>[http://www.wormbase.org/db/get?name=WBbt:0003966;class=Anatomy_term R9BR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004943;class=Anatomy_term CEMDR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003990;class=Anatomy_term R8BL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004001;class=Anatomy_term R7BL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004022;class=Anatomy_term R5BL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004048;class=Anatomy_term R1BL] | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00028448;class=Paper WBPaper00028448] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=nIs106;class=Transgene nIs106] | + | | [http://www.wormbase.org/db/get?name=nIs106;class=Transgene nIs106] |
+ | | [lin-11::gfp]. containing 5.2 kb of 5'UTR and ATG codon of lin-11. | ||
+ | | GFP | ||
+ | | | ||
+ | | X | ||
+ | | [http://www.wormbase.org/db/get?name=Marker17;class=Expr_pattern Marker17] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00003000;class=Gene lin-11] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0006893;class=Anatomy_term P5.p]<br>[http://www.wormbase.org/db/get?name=WBbt:0006895;class=Anatomy_term P7.p] | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00026909;class=Paper WBPaper00026909] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=nIs118;class=Transgene nIs118] | + | | [http://www.wormbase.org/db/get?name=nIs118;class=Transgene nIs118] |
+ | | [cat-2::gfp, lin-15] | ||
+ | | GFP | ||
+ | | | ||
+ | | X | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=nIs128;class=Transgene nIs128] | + | | [http://www.wormbase.org/db/get?name=nIs128;class=Transgene nIs128] |
+ | | [pkd-2::gfp] | ||
+ | | GFP | ||
+ | | | ||
+ | | II | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=nIs133;class=Transgene nIs133] | + | | [http://www.wormbase.org/db/get?name=nIs133;class=Transgene nIs133] |
+ | | [pkd-2::gfp] | ||
+ | | GFP | ||
+ | | | ||
+ | | I | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=nIs2;class=Transgene nIs2] | + | | [http://www.wormbase.org/db/get?name=nIs2;class=Transgene nIs2] |
+ | | [lin-11::lacZ; lin-11(+)] | ||
+ | | LacZ | ||
+ | | [http://www.wormbase.org/db/get?name=MT5788;class=Strain MT5788]<br>[http://www.wormbase.org/db/get?name=MT5790;class=Strain MT5790]<br>[http://www.wormbase.org/db/get?name=MT5797;class=Strain MT5797]<br>[http://www.wormbase.org/db/get?name=MT5798;class=Strain MT5798]<br>[http://www.wormbase.org/db/get?name=VT664;class=Strain VT664] | ||
+ | | IV | ||
+ | | [http://www.wormbase.org/db/get?name=Expr1033;class=Expr_pattern Expr1033] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00003000;class=Gene lin-11] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0006791;class=Anatomy_term uv1]<br>[http://www.wormbase.org/db/get?name=WBbt:0006789;class=Anatomy_term uterine seam cell] | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00003850;class=Paper WBPaper00003850] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=nIs51;class=Transgene nIs51] | + | | [http://www.wormbase.org/db/get?name=nIs51;class=Transgene nIs51] |
+ | | [egl-10(+)]. Integrated line overexpressing egl-10 genomic fragment | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=MT8190;class=Strain MT8190] | ||
+ | | X | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=nIs54;class=Transgene nIs54] | + | | [http://www.wormbase.org/db/get?name=nIs54;class=Transgene nIs54] |
+ | | [egl-10(+); lin-15(+)] | ||
+ | | | ||
+ | | | ||
+ | | X | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=nIs83;class=Transgene nIs83] | + | | [http://www.wormbase.org/db/get?name=nIs83;class=Transgene nIs83] |
+ | | [mec-4::gfp] | ||
+ | | GFP | ||
+ | | | ||
+ | | V | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=nIs96;class=Transgene nIs96] | + | | [http://www.wormbase.org/db/get?name=nIs96;class=Transgene nIs96] |
+ | | [lin-11::gfp]. containing 5.2 kb of 5'UTR and ATG codon of lin-11. | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=PS3493;class=Strain PS3493]<br>[http://www.wormbase.org/db/get?name=PS3494;class=Strain PS3494] | ||
+ | | V | ||
+ | | [http://www.wormbase.org/db/get?name=Expr2574;class=Expr_pattern Expr2574] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00003000;class=Gene lin-11] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0006765;class=Anatomy_term vulC]<br>[http://www.wormbase.org/db/get?name=WBbt:0006751;class=Anatomy_term head neuron]<br>[http://www.wormbase.org/db/get?name=WBbt:0004811;class=Anatomy_term proct]<br>[http://www.wormbase.org/db/get?name=WBbt:0005300;class=Anatomy_term ventral cord neuron]<br>[http://www.wormbase.org/db/get?name=WBbt:0006762;class=Anatomy_term vulA]<br>[http://www.wormbase.org/db/get?name=WBbt:0006784;class=Anatomy_term uterine toroidal epithelial cell]<br>[http://www.wormbase.org/db/get?name=WBbt:0006768;class=Anatomy_term vulF]<br>[http://www.wormbase.org/db/get?name=WBbt:0006767;class=Anatomy_term vulE]<br>[http://www.wormbase.org/db/get?name=WBbt:0006766;class=Anatomy_term vulD]<br>[http://www.wormbase.org/db/get?name=WBbt:0006764;class=Anatomy_term vulB2]<br>[http://www.wormbase.org/db/get?name=WBbt:0006759;class=Anatomy_term tail neuron]<br>[http://www.wormbase.org/db/get?name=WBbt:0006763;class=Anatomy_term vulB1] | ||
+ | | [http://www.wormbase.org/db/get?name=L4%20larva;class=Life_stage L4 larva]<br>[http://www.wormbase.org/db/get?name=adult;class=Life_stage adult] | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00005954;class=Paper WBPaper00005954] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=ncIs2;class=Transgene ncIs2] | + | | [http://www.wormbase.org/db/get?name=ncIs2;class=Transgene ncIs2] |
+ | | A promoter trap construct in which a genomic fragment drives the expression of GFP in all neurons. | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=ST2;class=Strain ST2]<br>[http://www.wormbase.org/db/get?name=ST15;class=Strain ST15]<br>[http://www.wormbase.org/db/get?name=ST16;class=Strain ST16]<br>[http://www.wormbase.org/db/get?name=ST20;class=Strain ST20]<br>[http://www.wormbase.org/db/get?name=ST21;class=Strain ST21]<br>[http://www.wormbase.org/db/get?name=ST22;class=Strain ST22]<br>[http://www.wormbase.org/db/get?name=ST30;class=Strain ST30]<br>[http://www.wormbase.org/db/get?name=ST35;class=Strain ST35] | ||
+ | | II | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=ncIs3;class=Transgene ncIs3] | + | | [http://www.wormbase.org/db/get?name=ncIs3;class=Transgene ncIs3] |
+ | | A promoter trap construct in which a genomic fragment drives the expression of GFP in all neurons. | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=ST29;class=Strain ST29]<br>[http://www.wormbase.org/db/get?name=ST53;class=Strain ST53] | ||
+ | | III | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=nrIs20;class=Transgene nrIs20] | + | | [http://www.wormbase.org/db/get?name=nrIs20;class=Transgene nrIs20] |
+ | | [sur-5::nls-gfp] | ||
+ | | GFP | ||
+ | | | ||
+ | | IV | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=nsIs105;class=Transgene nsIs105] | + | | [http://www.wormbase.org/db/get?name=nsIs105;class=Transgene nsIs105] |
+ | | [hlh-17::GFP] | ||
+ | | GFP | ||
+ | | | ||
+ | | I | ||
+ | | [http://www.wormbase.org/db/get?name=Marker29;class=Expr_pattern Marker29] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00001961;class=Gene hlh-17] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0004925;class=Anatomy_term CEPshVL]<br>[http://www.wormbase.org/db/get?name=WBbt:0005300;class=Anatomy_term ventral cord neuron]<br>[http://www.wormbase.org/db/get?name=WBbt:0004927;class=Anatomy_term CEPshDR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004923;class=Anatomy_term CEPshVR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004929;class=Anatomy_term CEPshDL] | ||
+ | | [http://www.wormbase.org/db/get?name=embryo;class=Life_stage embryo]<br>[http://www.wormbase.org/db/get?name=L1%20larva;class=Life_stage L1 larva]<br>[http://www.wormbase.org/db/get?name=L2%20larva;class=Life_stage L2 larva]<br>[http://www.wormbase.org/db/get?name=L3%20larva;class=Life_stage L3 larva]<br>[http://www.wormbase.org/db/get?name=L4%20larva;class=Life_stage L4 larva]<br>[http://www.wormbase.org/db/get?name=adult;class=Life_stage adult] | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00031917;class=Paper WBPaper00031917] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=nsIs136;class=Transgene nsIs136] | + | | [http://www.wormbase.org/db/get?name=nsIs136;class=Transgene nsIs136] |
+ | | [ptr-10::myrRFP] | ||
+ | | myrRFP | ||
+ | | | ||
+ | | IV | ||
+ | | [http://www.wormbase.org/db/get?name=Marker30;class=Expr_pattern Marker30] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00004224;class=Gene ptr-10] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0004519;class=Anatomy_term ILsoDR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004521;class=Anatomy_term ILsoDL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004533;class=Anatomy_term ILshDL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004370;class=Anatomy_term PDEshR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004925;class=Anatomy_term CEPshVL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004427;class=Anatomy_term OLQshVR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004531;class=Anatomy_term ILshDR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004440;class=Anatomy_term OLLsoR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004425;class=Anatomy_term OLQsoDR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004523;class=Anatomy_term ILshVR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004442;class=Anatomy_term OLLshR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004368;class=Anatomy_term PDEsoR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004927;class=Anatomy_term CEPshDR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004441;class=Anatomy_term OLLsoL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004518;class=Anatomy_term ILsoL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004428;class=Anatomy_term OLQshVL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004525;class=Anatomy_term ILshVL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004423;class=Anatomy_term OLQsoVR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004430;class=Anatomy_term OLQshDL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004501;class=Anatomy_term ILsoVR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004426;class=Anatomy_term OLQsoDL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004923;class=Anatomy_term CEPshVR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004005;class=Anatomy_term ADEshL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004529;class=Anatomy_term ILshL]<br>[http://www.wormbase.org/db/get?name=WBbt:0005603;class=Anatomy_term ADEsoR]<br>[http://www.wormbase.org/db/get?name=WBbt:0005602;class=Anatomy_term ADEsoL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004929;class=Anatomy_term CEPshDL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004503;class=Anatomy_term ILsoVL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004424;class=Anatomy_term OLQsoVL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004443;class=Anatomy_term OLLshL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004004;class=Anatomy_term ADEshR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004517;class=Anatomy_term ILsoR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004369;class=Anatomy_term PDEsoL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004371;class=Anatomy_term PDEshL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004527;class=Anatomy_term ILshR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004429;class=Anatomy_term OLQshDR] | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00031917;class=Paper WBPaper00031917] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=nsIs145;class=Transgene nsIs145] | + | | [http://www.wormbase.org/db/get?name=nsIs145;class=Transgene nsIs145] |
+ | | [ttx-1::RFP] | ||
+ | | RFP | ||
+ | | | ||
+ | | V | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=nsIs25;class=Transgene nsIs25] | + | | [http://www.wormbase.org/db/get?name=nsIs25;class=Transgene nsIs25] |
+ | | [(cb)ced-3::gfp] | ||
+ | | GFP | ||
+ | | | ||
+ | | X | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=ntIs1;class=Transgene ntIs1] | + | | [http://www.wormbase.org/db/get?name=ntIs1;class=Transgene ntIs1] |
+ | | [gcy-5::gfp] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=OH2871;class=Strain OH2871]<br>[http://www.wormbase.org/db/get?name=OH3192;class=Strain OH3192] | ||
+ | | V | ||
+ | | [http://www.wormbase.org/db/get?name=Marker14;class=Expr_pattern Marker14] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00001532;class=Gene gcy-5] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0003903;class=Anatomy_term ASER] | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00028862;class=Paper WBPaper00028862] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=nuIs1;class=Transgene nuIs1] | + | | [http://www.wormbase.org/db/get?name=nuIs1;class=Transgene nuIs1] |
+ | | [glr-1::gfp] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=KP987;class=Strain KP987] | ||
+ | | X | ||
+ | | [http://www.wormbase.org/db/get?name=Marker60;class=Expr_pattern Marker60] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00001612;class=Gene glr-1] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0005045;class=Anatomy_term RIS] | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00006180;class=Paper WBPaper00006180] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=nuIs11;class=Transgene nuIs11] | + | | [http://www.wormbase.org/db/get?name=nuIs11;class=Transgene nuIs11] |
+ | | [osm-10::gfp] translated fusion | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=HA3;class=Strain HA3]<br>[http://www.wormbase.org/db/get?name=OH4769;class=Strain OH4769] | ||
+ | | I | ||
+ | | [http://www.wormbase.org/db/get?name=Expr1266;class=Expr_pattern Expr1266] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00003890;class=Gene osm-10] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0003887;class=Anatomy_term ASIR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004365;class=Anatomy_term PHAR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003889;class=Anatomy_term ASHR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004366;class=Anatomy_term PHAL]<br>[http://www.wormbase.org/db/get?name=WBbt:0005659;class=Anatomy_term PHBR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004364;class=Anatomy_term PHBL]<br>[http://www.wormbase.org/db/get?name=WBbt:0003890;class=Anatomy_term ASHL]<br>[http://www.wormbase.org/db/get?name=WBbt:0003888;class=Anatomy_term ASIL] | ||
+ | | [http://www.wormbase.org/db/get?name=postembryonic;class=Life_stage postembryonic] | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00003408;class=Paper WBPaper00003408] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=nuIs9;class=Transgene nuIs9] | + | | [http://www.wormbase.org/db/get?name=nuIs9;class=Transgene nuIs9] |
+ | | [unc-5B::gfp; myo-3::lacZ; dpy-20(+)] | ||
+ | | LacZ | ||
+ | | | ||
+ | | I | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=opIs110;class=Transgene opIs110] | + | | [http://www.wormbase.org/db/get?name=opIs110;class=Transgene opIs110] |
+ | | [lim-7::yfp-act-5] | ||
+ | | YFP | ||
+ | | | ||
+ | | IV | ||
+ | | [http://www.wormbase.org/db/get?name=Expr3724;class=Expr_pattern Expr3724] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00000067;class=Gene act-5] | ||
+ | | | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00025002;class=Paper WBPaper00025002] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=opIs160;class=Transgene opIs160] | + | | [http://www.wormbase.org/db/get?name=opIs160;class=Transgene opIs160] |
+ | | [yfp::ced-6; unc-119(+)] | ||
+ | | YFP | ||
+ | | | ||
+ | | X | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=opIs64;class=Transgene opIs64] | + | | [http://www.wormbase.org/db/get?name=opIs64;class=Transgene opIs64] |
+ | | [gla-3a::2xNLS-gfp unc-119(+)] | ||
+ | | GFP | ||
+ | | | ||
+ | | III | ||
+ | | [http://www.wormbase.org/db/get?name=Expr7991;class=Expr_pattern Expr7991] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00011376;class=Gene gla-3] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0003675;class=Anatomy_term muscle cell]<br>[http://www.wormbase.org/db/get?name=WBbt:0005784;class=Anatomy_term germ line] | ||
+ | | [http://www.wormbase.org/db/get?name=embryo;class=Life_stage embryo]<br>[http://www.wormbase.org/db/get?name=L4%20larva;class=Life_stage L4 larva]<br>[http://www.wormbase.org/db/get?name=adult;class=Life_stage adult] | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00028398;class=Paper WBPaper00028398] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=otIs114;class=Transgene otIs114] | + | | [http://www.wormbase.org/db/get?name=otIs114;class=Transgene otIs114] |
+ | | [lim-6::gfp, rol-6(d)] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=OH707;class=Strain OH707]<br>[http://www.wormbase.org/db/get?name=OH812;class=Strain OH812]<br>[http://www.wormbase.org/db/get?name=OH1571;class=Strain OH1571]<br>[http://www.wormbase.org/db/get?name=OH3491;class=Strain OH3491]<br>[http://www.wormbase.org/db/get?name=OH3556;class=Strain OH3556]<br>[http://www.wormbase.org/db/get?name=OH3568;class=Strain OH3568]<br>[http://www.wormbase.org/db/get?name=OH3645;class=Strain OH3645]<br>[http://www.wormbase.org/db/get?name=OH3646;class=Strain OH3646]<br>[http://www.wormbase.org/db/get?name=OH3679;class=Strain OH3679]<br>[http://www.wormbase.org/db/get?name=OH3681;class=Strain OH3681]<br>[http://www.wormbase.org/db/get?name=OH3754;class=Strain OH3754]<br>[http://www.wormbase.org/db/get?name=OH3895;class=Strain OH3895]<br>[http://www.wormbase.org/db/get?name=OH3900;class=Strain OH3900]<br>[http://www.wormbase.org/db/get?name=OH3902;class=Strain OH3902]<br>[http://www.wormbase.org/db/get?name=OH3959;class=Strain OH3959]<br>[http://www.wormbase.org/db/get?name=OH3962;class=Strain OH3962]<br>[http://www.wormbase.org/db/get?name=OH4013;class=Strain OH4013]<br>[http://www.wormbase.org/db/get?name=OH4027;class=Strain OH4027]<br>[http://www.wormbase.org/db/get?name=OH4176;class=Strain OH4176]<br>[http://www.wormbase.org/db/get?name=OH4830;class=Strain OH4830]<br>[http://www.wormbase.org/db/get?name=OH4974;class=Strain OH4974]<br>[http://www.wormbase.org/db/get?name=OH7115;class=Strain OH7115] | ||
+ | | I | ||
+ | | [http://www.wormbase.org/db/get?name=Marker41;class=Expr_pattern Marker41] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00002988;class=Gene lim-6] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0005776;class=Anatomy_term excretory gland cell]<br>[http://www.wormbase.org/db/get?name=WBbt:0003904;class=Anatomy_term ASEL] | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00006052;class=Paper WBPaper00006052] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=otIs125;class=Transgene otIs125] | + | | [http://www.wormbase.org/db/get?name=otIs125;class=Transgene otIs125] |
+ | | [flp-6::gfp] | ||
+ | | GFP | ||
+ | | | ||
+ | | X | ||
+ | | [http://www.wormbase.org/db/get?name=Marker42;class=Expr_pattern Marker42] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00001449;class=Gene flp-6] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0004003;class=Anatomy_term ADFL]<br>[http://www.wormbase.org/db/get?name=WBbt:0003904;class=Anatomy_term ASEL]<br>[http://www.wormbase.org/db/get?name=WBbt:0003993;class=Anatomy_term AFDL]<br>[http://www.wormbase.org/db/get?name=WBbt:0003991;class=Anatomy_term AFDR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003999;class=Anatomy_term ADFR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003903;class=Anatomy_term ASER] | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00006052;class=Paper WBPaper00006052] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=otIs13;class=Transgene otIs13] | + | | [http://www.wormbase.org/db/get?name=otIs13;class=Transgene otIs13] |
+ | | [zig-3::gfp] promoter fusion. PCR product of the promoter region -4449 to -1 relative to ATG were fused to the polylinker of the gfp vector pPD95.75. | ||
+ | | GFP | ||
+ | | | ||
+ | | I | ||
+ | | [http://www.wormbase.org/db/get?name=Expr1749;class=Expr_pattern Expr1749] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00006980;class=Gene zig-3] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0003887;class=Anatomy_term ASIR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004070;class=Anatomy_term PVT]<br>[http://www.wormbase.org/db/get?name=WBbt:0003969;class=Anatomy_term AIMR]<br>[http://www.wormbase.org/db/get?name=WBbt:0006748;class=Anatomy_term vulva]<br>[http://www.wormbase.org/db/get?name=WBbt:0005813;class=Anatomy_term body wall musculature]<br>[http://www.wormbase.org/db/get?name=WBbt:0003888;class=Anatomy_term ASIL]<br>[http://www.wormbase.org/db/get?name=WBbt:0003983;class=Anatomy_term AIML] | ||
+ | | [http://www.wormbase.org/db/get?name=postembryonic;class=Life_stage postembryonic] | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00005064;class=Paper WBPaper00005064] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=otIs3;class=Transgene otIs3] | + | | [http://www.wormbase.org/db/get?name=otIs3;class=Transgene otIs3] |
+ | | [gcy-7::gfp] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=OH3191;class=Strain OH3191]<br>[http://www.wormbase.org/db/get?name=OH4605;class=Strain OH4605]<br>[http://www.wormbase.org/db/get?name=OH7116;class=Strain OH7116]<br>[http://www.wormbase.org/db/get?name=OH811;class=Strain OH811] | ||
+ | | V | ||
+ | | [http://www.wormbase.org/db/get?name=Marker13;class=Expr_pattern Marker13] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00001534;class=Gene gcy-7] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0003904;class=Anatomy_term ASEL] | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00028862;class=Paper WBPaper00028862] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=otIs33;class=Transgene otIs33] | + | | [http://www.wormbase.org/db/get?name=otIs33;class=Transgene otIs33] |
+ | | [kal-1::gfp] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=OH904;class=Strain OH904] | ||
+ | | IV | ||
+ | | [http://www.wormbase.org/db/get?name=Marker49;class=Expr_pattern Marker49] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00002181;class=Gene kal-1] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0004757;class=Anatomy_term HSNR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003887;class=Anatomy_term ASIR]<br>[http://www.wormbase.org/db/get?name=WBbt:0005812;class=Anatomy_term excretory cell]<br>[http://www.wormbase.org/db/get?name=WBbt:0004947;class=Anatomy_term CANR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004949;class=Anatomy_term CANL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004821;class=Anatomy_term DVC]<br>[http://www.wormbase.org/db/get?name=WBbt:0003963;class=Anatomy_term AIYL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004086;class=Anatomy_term PVM]<br>[http://www.wormbase.org/db/get?name=WBbt:0005300;class=Anatomy_term ventral cord neuron]<br>[http://www.wormbase.org/db/get?name=WBbt:0004465;class=Anatomy_term M5]<br>[http://www.wormbase.org/db/get?name=WBbt:0005117;class=Anatomy_term inner labial neuron]<br>[http://www.wormbase.org/db/get?name=WBbt:0003957;class=Anatomy_term AIZR]<br>[http://www.wormbase.org/db/get?name=WBbt:0006801;class=Anatomy_term outer labial neuron]<br>[http://www.wormbase.org/db/get?name=WBbt:0004385;class=Anatomy_term PDB]<br>[http://www.wormbase.org/db/get?name=WBbt:0004822;class=Anatomy_term DVB]<br>[http://www.wormbase.org/db/get?name=WBbt:0003959;class=Anatomy_term AIZL]<br>[http://www.wormbase.org/db/get?name=WBbt:0003938;class=Anatomy_term RID]<br>[http://www.wormbase.org/db/get?name=WBbt:0005342;class=Anatomy_term uterine muscle]<br>[http://www.wormbase.org/db/get?name=WBbt:0003961;class=Anatomy_term AIYR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003888;class=Anatomy_term ASIL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004758;class=Anatomy_term HSNL] | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00004727;class=Paper WBPaper00004727] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=otIs33;class=Transgene otIs33] | + | | [http://www.wormbase.org/db/get?name=otIs33;class=Transgene otIs33] |
+ | | [kal-1::gfp] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=OH904;class=Strain OH904] | ||
+ | | IV | ||
+ | | [http://www.wormbase.org/db/get?name=Marker64;class=Expr_pattern Marker64] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00002181;class=Gene kal-1] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0003938;class=Anatomy_term RID] | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00006180;class=Paper WBPaper00006180] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=otIs35;class=Transgene otIs35] | + | | [http://www.wormbase.org/db/get?name=otIs35;class=Transgene otIs35] |
+ | | [ttx-3::kal-1] | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=OH911;class=Strain OH911]<br>[http://www.wormbase.org/db/get?name=OH2018;class=Strain OH2018] | ||
+ | | X | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=otIs45;class=Transgene otIs45] | + | | [http://www.wormbase.org/db/get?name=otIs45;class=Transgene otIs45] |
+ | | [unc-119::gfp] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=OH441;class=Strain OH441] | ||
+ | | V | ||
+ | | [http://www.wormbase.org/db/get?name=Marker50;class=Expr_pattern Marker50] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00006843;class=Gene unc-119] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0003679;class=Anatomy_term neuron] | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00004727;class=Paper WBPaper00004727] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=otIs76;class=Transgene otIs76] | + | | [http://www.wormbase.org/db/get?name=otIs76;class=Transgene otIs76] |
+ | | [ttx-3::kal-1] | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=OH160;class=Strain OH160]<br>[http://www.wormbase.org/db/get?name=OH912;class=Strain OH912] | ||
+ | | IV | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=otIs77;class=Transgene otIs77] | + | | [http://www.wormbase.org/db/get?name=otIs77;class=Transgene otIs77] |
+ | | [ttx-3::kal-1] | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=OH910;class=Strain OH910]<br>[http://www.wormbase.org/db/get?name=NP97;class=Strain NP97] | ||
+ | | II | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=otIs80;class=Transgene otIs80] | + | | [http://www.wormbase.org/db/get?name=otIs80;class=Transgene otIs80] |
+ | | [unc-119::kal-1] | ||
+ | | | ||
+ | | | ||
+ | | IV | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=otIs81;class=Transgene otIs81] | + | | [http://www.wormbase.org/db/get?name=otIs81;class=Transgene otIs81] |
+ | | [unc-119::kal-1] | ||
+ | | | ||
+ | | | ||
+ | | II | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=otIs83;class=Transgene otIs83] | + | | [http://www.wormbase.org/db/get?name=otIs83;class=Transgene otIs83] |
+ | | [gcy-8::kal-1] | ||
+ | | | ||
+ | | | ||
+ | | V | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=otIs92;class=Transgene otIs92] | + | | [http://www.wormbase.org/db/get?name=otIs92;class=Transgene otIs92] |
+ | | [flp-10::gfp]. Derived from an extrachromosomal array provided by C. Li | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=OH4841;class=Strain OH4841] | ||
+ | | V | ||
+ | | [http://www.wormbase.org/db/get?name=Expr3011;class=Expr_pattern Expr3011] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00001453;class=Gene flp-10] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0003871;class=Anatomy_term AUAR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003887;class=Anatomy_term ASIR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004096;class=Anatomy_term PQR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004072;class=Anatomy_term PVR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003969;class=Anatomy_term AIMR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003812;class=Anatomy_term BDUL]<br>[http://www.wormbase.org/db/get?name=WBbt:0003824;class=Anatomy_term BAGL]<br>[http://www.wormbase.org/db/get?name=WBbt:0003872;class=Anatomy_term AUAL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004822;class=Anatomy_term DVB]<br>[http://www.wormbase.org/db/get?name=WBbt:0004926;class=Anatomy_term URXR]<br>[http://www.wormbase.org/db/get?name=WBbt:0006766;class=Anatomy_term vulD]<br>[http://www.wormbase.org/db/get?name=WBbt:0004928;class=Anatomy_term URXL]<br>[http://www.wormbase.org/db/get?name=WBbt:0003811;class=Anatomy_term BDUR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003888;class=Anatomy_term ASIL]<br>[http://www.wormbase.org/db/get?name=WBbt:0003983;class=Anatomy_term AIML]<br>[http://www.wormbase.org/db/get?name=WBbt:0003823;class=Anatomy_term BAGR] | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00024197;class=Paper WBPaper00024197] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=otIs93;class=Transgene otIs93] | + | | [http://www.wormbase.org/db/get?name=otIs93;class=Transgene otIs93] |
+ | | [flp-10::gfp] | ||
+ | | GFP | ||
+ | | | ||
+ | | II | ||
+ | | [http://www.wormbase.org/db/get?name=Expr3011;class=Expr_pattern Expr3011] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00001453;class=Gene flp-10] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0003871;class=Anatomy_term AUAR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003887;class=Anatomy_term ASIR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004096;class=Anatomy_term PQR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004072;class=Anatomy_term PVR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003969;class=Anatomy_term AIMR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003812;class=Anatomy_term BDUL]<br>[http://www.wormbase.org/db/get?name=WBbt:0003824;class=Anatomy_term BAGL]<br>[http://www.wormbase.org/db/get?name=WBbt:0003872;class=Anatomy_term AUAL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004822;class=Anatomy_term DVB]<br>[http://www.wormbase.org/db/get?name=WBbt:0004926;class=Anatomy_term URXR]<br>[http://www.wormbase.org/db/get?name=WBbt:0006766;class=Anatomy_term vulD]<br>[http://www.wormbase.org/db/get?name=WBbt:0004928;class=Anatomy_term URXL]<br>[http://www.wormbase.org/db/get?name=WBbt:0003811;class=Anatomy_term BDUR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003888;class=Anatomy_term ASIL]<br>[http://www.wormbase.org/db/get?name=WBbt:0003983;class=Anatomy_term AIML]<br>[http://www.wormbase.org/db/get?name=WBbt:0003823;class=Anatomy_term BAGR] | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00024197;class=Paper WBPaper00024197] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=otIs97;class=Transgene otIs97] | + | | [http://www.wormbase.org/db/get?name=otIs97;class=Transgene otIs97] |
+ | | [unc-119::ttx-3; pRF4] | ||
+ | | | ||
+ | | | ||
+ | | IV | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=oxIs107;class=Transgene oxIs107] | + | | [http://www.wormbase.org/db/get?name=oxIs107;class=Transgene oxIs107] |
+ | | [rab-3::UNC-70(5ng/uL); myo-2::GFP(2ng/uL); lin-15(+)]. For oxIs107, the extrachromosomal array oxEx506, containing rab-3::UNC-70(5ng/uL), myo-2::GFP(2ng/uL), and lin-15(+) 80ng/uL, was generated by standard microinjection techniques. This array was then integrated by X-ray irradiation to generate oxIs107, mapped 8/38 to dpy-11. | ||
+ | | GFP | ||
+ | | | ||
+ | | V | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=oxIs12;class=Transgene oxIs12] | + | | [http://www.wormbase.org/db/get?name=oxIs12;class=Transgene oxIs12] |
+ | | [unc-47::gfp] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=EG1285;class=Strain EG1285]<br>[http://www.wormbase.org/db/get?name=HJ1;class=Strain HJ1]<br>[http://www.wormbase.org/db/get?name=HJ154;class=Strain HJ154]<br>[http://www.wormbase.org/db/get?name=OH775;class=Strain OH775]<br>[http://www.wormbase.org/db/get?name=OH1003;class=Strain OH1003]<br>[http://www.wormbase.org/db/get?name=OH1476;class=Strain OH1476]<br>[http://www.wormbase.org/db/get?name=OH1589;class=Strain OH1589]<br>[http://www.wormbase.org/db/get?name=OH2000;class=Strain OH2000]<br>[http://www.wormbase.org/db/get?name=OH2096;class=Strain OH2096]<br>[http://www.wormbase.org/db/get?name=OH2344;class=Strain OH2344]<br>[http://www.wormbase.org/db/get?name=OH2345;class=Strain OH2345]<br>[http://www.wormbase.org/db/get?name=OH2346;class=Strain OH2346]<br>[http://www.wormbase.org/db/get?name=OH2347;class=Strain OH2347]<br>[http://www.wormbase.org/db/get?name=OH2382;class=Strain OH2382]<br>[http://www.wormbase.org/db/get?name=OH2383;class=Strain OH2383]<br>[http://www.wormbase.org/db/get?name=EG1524;class=Strain EG1524]<br>[http://www.wormbase.org/db/get?name=VH431;class=Strain VH431]<br>[http://www.wormbase.org/db/get?name=VH984;class=Strain VH984]<br>[http://www.wormbase.org/db/get?name=EG1306;class=Strain EG1306] | ||
+ | | X | ||
+ | | [http://www.wormbase.org/db/get?name=Marker21;class=Expr_pattern Marker21] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00006783;class=Gene unc-47] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0005190;class=Anatomy_term GABAergic neuron] | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00031112;class=Paper WBPaper00031112] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=oxIs131;class=Transgene oxIs131] | + | | [http://www.wormbase.org/db/get?name=oxIs131;class=Transgene oxIs131] |
+ | | [rab-3::UNC-70 (5ng/uL); unc-129::GFP(20ng/uL); and lin-15(+)(80ng/uL)]. The starting array was oxEx508, containing rab-3::UNC-70 (5ng/uL), unc-129::GFP(20ng/uL), and lin-15(+)(80ng/uL). The integrant mapped 0/12 to dpy-11. | ||
+ | | GFP | ||
+ | | | ||
+ | | V | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=oxIs25;class=Transgene oxIs25] | + | | [http://www.wormbase.org/db/get?name=oxIs25;class=Transgene oxIs25] |
+ | | [Mos1; rol-6(sd)] The Mos1-containing array oxEx164[Mos1; rol-6(sd)] was built by injecting a fragment containing the 1.3-kb Mos1 element flanked by Drosophila simulans sequences18 (10 ng/ml) and a fragment of pRF4(rol-6(sd) (10 ng/ml). The integrated array oxIs25[Mos1; rol-6(sd)] contained 1520 Mos1 elements as determined by Southern blot analysis. | ||
+ | | | ||
+ | | | ||
+ | | V | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=oxIs30;class=Transgene oxIs30] | + | | [http://www.wormbase.org/db/get?name=oxIs30;class=Transgene oxIs30] |
+ | | [Mos1 Transposase] | ||
+ | | | ||
+ | | | ||
+ | | X | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=oxIs33;class=Transgene oxIs33] | + | | [http://www.wormbase.org/db/get?name=oxIs33;class=Transgene oxIs33] |
+ | | [unc-64(+); unc-122::gfp] | ||
+ | | GFP | ||
+ | | | ||
+ | | I | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=oxIs34;class=Transgene oxIs34] | + | | [http://www.wormbase.org/db/get?name=oxIs34;class=Transgene oxIs34] |
+ | | [unc-64(L166A/E167A); myo-2::gfp] | ||
+ | | GFP | ||
+ | | | ||
+ | | III | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=oxIs95;class=Transgene oxIs95] | + | | [http://www.wormbase.org/db/get?name=oxIs95;class=Transgene oxIs95] |
+ | | [pdi-2::unc-70] | ||
+ | | | ||
+ | | | ||
+ | | IV | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=oyIs14;class=Transgene oyIs14] | + | | [http://www.wormbase.org/db/get?name=oyIs14;class=Transgene oyIs14] |
+ | | [sra-6::gfp] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=OH2638;class=Strain OH2638]<br>[http://www.wormbase.org/db/get?name=OH2639;class=Strain OH2639]<br>[http://www.wormbase.org/db/get?name=OH3313;class=Strain OH3313]<br>[http://www.wormbase.org/db/get?name=OH3314;class=Strain OH3314]<br>[http://www.wormbase.org/db/get?name=OH3455;class=Strain OH3455]<br>[http://www.wormbase.org/db/get?name=OH3467;class=Strain OH3467]<br>[http://www.wormbase.org/db/get?name=OH3478;class=Strain OH3478]<br>[http://www.wormbase.org/db/get?name=OH4124;class=Strain OH4124]<br>[http://www.wormbase.org/db/get?name=OH4127;class=Strain OH4127]<br>[http://www.wormbase.org/db/get?name=OH4139;class=Strain OH4139]<br>[http://www.wormbase.org/db/get?name=OH4140;class=Strain OH4140]<br>[http://www.wormbase.org/db/get?name=PY1058;class=Strain PY1058]<br>[http://www.wormbase.org/db/get?name=CX5334;class=Strain CX5334] | ||
+ | | V | ||
+ | | [http://www.wormbase.org/db/get?name=Marker47;class=Expr_pattern Marker47] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00005032;class=Gene sra-6] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0004076;class=Anatomy_term PVQL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004074;class=Anatomy_term PVQR] | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00005633;class=Paper WBPaper00005633] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=pkIs1600;class=Transgene pkIs1600] | + | | [http://www.wormbase.org/db/get?name=pkIs1600;class=Transgene pkIs1600] |
+ | | [dpy-30::gfp{Delta}::unc-54; pRF4(rol-6(su1006))] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=NL3847;class=Strain NL3847] | ||
+ | | I | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=pkIs296;class=Transgene pkIs296] | + | | [http://www.wormbase.org/db/get?name=pkIs296;class=Transgene pkIs296] |
+ | | [hsp::gsa-1(Q208L); dpy-20(+)] | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=NL545;class=Strain NL545]<br>[http://www.wormbase.org/db/get?name=NL585;class=Strain NL585]<br>[http://www.wormbase.org/db/get?name=NL587;class=Strain NL587]<br>[http://www.wormbase.org/db/get?name=NL597;class=Strain NL597]<br>[http://www.wormbase.org/db/get?name=NL1236;class=Strain NL1236]<br>[http://www.wormbase.org/db/get?name=NL1908;class=Strain NL1908]<br>[http://www.wormbase.org/db/get?name=NL1909;class=Strain NL1909]<br>[http://www.wormbase.org/db/get?name=NL1921;class=Strain NL1921]<br>[http://www.wormbase.org/db/get?name=NL1925;class=Strain NL1925]<br>[http://www.wormbase.org/db/get?name=NL1947;class=Strain NL1947]<br>[http://www.wormbase.org/db/get?name=NL3231;class=Strain NL3231]<br>[http://www.wormbase.org/db/get?name=NL520;class=Strain NL520] | ||
+ | | X | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=pkIs41;class=Transgene pkIs41] | + | | [http://www.wormbase.org/db/get?name=pkIs41;class=Transgene pkIs41] |
+ | | [kin-29::gfp] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=PY3018;class=Strain PY3018] | ||
+ | | IV | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=pmid16204351Is1;class=Transgene pmid16204351Is1] | + | | [http://www.wormbase.org/db/get?name=pmid16204351Is1;class=Transgene pmid16204351Is1] |
+ | | [aex-3::{alpha}-synuclein(A53T); Pdat-1::gfp] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=WG8;class=Strain WG8] | ||
+ | | IV | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=qIs19;class=Transgene qIs19] | + | | [http://www.wormbase.org/db/get?name=qIs19;class=Transgene qIs19] |
+ | | An integration of [lag-2::gfp] on Chromosome V. | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=JK2049;class=Strain JK2049]<br>[http://www.wormbase.org/db/get?name=YG1011;class=Strain YG1011]<br>[http://www.wormbase.org/db/get?name=JK2822;class=Strain JK2822] | ||
+ | | V | ||
+ | | [http://www.wormbase.org/db/get?name=Expr3843;class=Expr_pattern Expr3843] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00002246;class=Gene lag-2] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0005063;class=Anatomy_term gon_male_dtc]<br>[http://www.wormbase.org/db/get?name=WBbt:0005064;class=Anatomy_term gon_male_dtc]<br>[http://www.wormbase.org/db/get?name=WBbt:0004506;class=Anatomy_term gon_herm_dtc_P]<br>[http://www.wormbase.org/db/get?name=WBbt:0004520;class=Anatomy_term gon_herm_dtc_A]<br>[http://www.wormbase.org/db/get?name=WBbt:0005062;class=Anatomy_term linker cell] | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00005116;class=Paper WBPaper00005116] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=qIs23;class=Transgene qIs23] | + | | [http://www.wormbase.org/db/get?name=qIs23;class=Transgene qIs23] |
+ | | An integration of [lag-2::gfp] on Chromosome I. | ||
+ | | GFP | ||
+ | | | ||
+ | | I | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=qIs42;class=Transgene qIs42] | + | | [http://www.wormbase.org/db/get?name=qIs42;class=Transgene qIs42] |
+ | | [pha-4::gfp; pRF4] | ||
+ | | GFP | ||
+ | | | ||
+ | | IV | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=qIs54;class=Transgene qIs54] | + | | [http://www.wormbase.org/db/get?name=qIs54;class=Transgene qIs54] |
+ | | [myo-2::GFP, pes-10::GFP, gut promoter::GFP] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=JK2735;class=Strain JK2735] | ||
+ | | X | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=qIs56;class=Transgene qIs56] | + | | [http://www.wormbase.org/db/get?name=qIs56;class=Transgene qIs56] |
+ | | [lag-2::gfp; unc-119(+)] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=JK2868;class=Strain JK2868] | ||
+ | | V | ||
+ | | [http://www.wormbase.org/db/get?name=Expr3843;class=Expr_pattern Expr3843] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00002246;class=Gene lag-2] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0005063;class=Anatomy_term gon_male_dtc]<br>[http://www.wormbase.org/db/get?name=WBbt:0005064;class=Anatomy_term gon_male_dtc]<br>[http://www.wormbase.org/db/get?name=WBbt:0004506;class=Anatomy_term gon_herm_dtc_P]<br>[http://www.wormbase.org/db/get?name=WBbt:0004520;class=Anatomy_term gon_herm_dtc_A]<br>[http://www.wormbase.org/db/get?name=WBbt:0005062;class=Anatomy_term linker cell] | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00005116;class=Paper WBPaper00005116] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=qIs56;class=Transgene qIs56] | + | | [http://www.wormbase.org/db/get?name=qIs56;class=Transgene qIs56] |
+ | | [lag-2::gfp; unc-119(+)] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=JK2868;class=Strain JK2868] | ||
+ | | V | ||
+ | | [http://www.wormbase.org/db/get?name=Expr8182;class=Expr_pattern Expr8182] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00002246;class=Gene lag-2] | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=dauer%20larva;class=Life_stage dauer larva] | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00031997;class=Paper WBPaper00031997] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=qIs57;class=Transgene qIs57] | + | | [http://www.wormbase.org/db/get?name=qIs57;class=Transgene qIs57] |
+ | | [lag-2::gfp] | ||
+ | | GFP | ||
+ | | | ||
+ | | II | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=qIs95;class=Transgene qIs95] | + | | [http://www.wormbase.org/db/get?name=qIs95;class=Transgene qIs95] |
+ | | [sys-1::VENUS::SYS-1] | ||
+ | | VENUS | ||
+ | | [http://www.wormbase.org/db/get?name=JK3791;class=Strain JK3791] | ||
+ | | III | ||
+ | | [http://www.wormbase.org/db/get?name=Expr4710;class=Expr_pattern Expr4710] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00006379;class=Gene sys-1] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0007026;class=Anatomy_term Z1.aa]<br>[http://www.wormbase.org/db/get?name=WBbt:0004506;class=Anatomy_term gon_herm_dtc_P] | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00029120;class=Paper WBPaper00029120] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=qaIs2241;class=Transgene qaIs2241] | + | | [http://www.wormbase.org/db/get?name=qaIs2241;class=Transgene qaIs2241] |
+ | | [gcy-36::egl-1, gcy-35::gfp, lin-15(+)] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=CX7102;class=Strain CX7102] | ||
+ | | X | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=quIs5;class=Transgene quIs5] | + | | [http://www.wormbase.org/db/get?name=quIs5;class=Transgene quIs5] |
+ | | [mec-4::myr-vab-1] | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=IC400;class=Strain IC400] | ||
+ | | II | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=rhIs13;class=Transgene rhIs13] | + | | [http://www.wormbase.org/db/get?name=rhIs13;class=Transgene rhIs13] |
+ | | [unc-119::gfp] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=VH624;class=Strain VH624]<br>[http://www.wormbase.org/db/get?name=VH41;class=Strain VH41] | ||
+ | | V | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=rhIs16;class=Transgene rhIs16] | + | | [http://www.wormbase.org/db/get?name=rhIs16;class=Transgene rhIs16] |
+ | | [glr-1::CFP; dpy-20(+)] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=VH94;class=Strain VH94] | ||
+ | | X | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=rhIs23;class=Transgene rhIs23] | + | | [http://www.wormbase.org/db/get?name=rhIs23;class=Transgene rhIs23] |
+ | | [him-4::gfp] translational fusion. Using overlapping PCR primers, a unique SacII restriction site was insertedinto the hemicentin coding region, changing nucleotides F15G9:13,573-13,578 to ATC.TGG.CCC.GCG.GTC.TTC. The coding sequence for GFP from plasmid pPD113.54 was inserted in-frame into this restriction site. | ||
+ | | GFP | ||
+ | | | ||
+ | | III | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=rhIs4;class=Transgene rhIs4] | + | | [http://www.wormbase.org/db/get?name=rhIs4;class=Transgene rhIs4] |
+ | | [glr-1::gfp] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=OH4120;class=Strain OH4120]<br>[http://www.wormbase.org/db/get?name=OH4132;class=Strain OH4132]<br>[http://www.wormbase.org/db/get?name=OH4136;class=Strain OH4136]<br>[http://www.wormbase.org/db/get?name=VH4;class=Strain VH4]<br>[http://www.wormbase.org/db/get?name=VH17;class=Strain VH17]<br>[http://www.wormbase.org/db/get?name=VH1160;class=Strain VH1160]<br>[http://www.wormbase.org/db/get?name=IM175;class=Strain IM175]<br>[http://www.wormbase.org/db/get?name=IM202;class=Strain IM202]<br>[http://www.wormbase.org/db/get?name=IM205;class=Strain IM205]<br>[http://www.wormbase.org/db/get?name=IM485;class=Strain IM485]<br>[http://www.wormbase.org/db/get?name=IM206;class=Strain IM206]<br>[http://www.wormbase.org/db/get?name=IM484;class=Strain IM484]<br>[http://www.wormbase.org/db/get?name=IM486;class=Strain IM486]<br>[http://www.wormbase.org/db/get?name=IM487;class=Strain IM487]<br>[http://www.wormbase.org/db/get?name=IM488;class=Strain IM488]<br>[http://www.wormbase.org/db/get?name=IM498;class=Strain IM498]<br>[http://www.wormbase.org/db/get?name=IM499;class=Strain IM499]<br>[http://www.wormbase.org/db/get?name=IM500;class=Strain IM500]<br>[http://www.wormbase.org/db/get?name=IM507;class=Strain IM507]<br>[http://www.wormbase.org/db/get?name=IM508;class=Strain IM508]<br>[http://www.wormbase.org/db/get?name=IM509;class=Strain IM509]<br>[http://www.wormbase.org/db/get?name=IM516;class=Strain IM516]<br>[http://www.wormbase.org/db/get?name=IM517;class=Strain IM517]<br>[http://www.wormbase.org/db/get?name=IM518;class=Strain IM518]<br>[http://www.wormbase.org/db/get?name=IM525;class=Strain IM525]<br>[http://www.wormbase.org/db/get?name=IM526;class=Strain IM526]<br>[http://www.wormbase.org/db/get?name=IM527;class=Strain IM527]<br>[http://www.wormbase.org/db/get?name=IM534;class=Strain IM534]<br>[http://www.wormbase.org/db/get?name=IM535;class=Strain IM535]<br>[http://www.wormbase.org/db/get?name=IM536;class=Strain IM536]<br>[http://www.wormbase.org/db/get?name=IM543;class=Strain IM543]<br>[http://www.wormbase.org/db/get?name=IM203;class=Strain IM203]<br>[http://www.wormbase.org/db/get?name=IM204;class=Strain IM204]<br>[http://www.wormbase.org/db/get?name=IM546;class=Strain IM546]<br>[http://www.wormbase.org/db/get?name=IM549;class=Strain IM549]<br>[http://www.wormbase.org/db/get?name=IM336;class=Strain IM336]<br>[http://www.wormbase.org/db/get?name=VH616;class=Strain VH616]<br>[http://www.wormbase.org/db/get?name=VH15;class=Strain VH15] | ||
+ | | III | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=rrIs1;class=Transgene rrIs1] | + | | [http://www.wormbase.org/db/get?name=rrIs1;class=Transgene rrIs1] |
+ | | [elt-2::GFP, unc-119(+)] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=MR142;class=Strain MR142]<br>[http://www.wormbase.org/db/get?name=MR164;class=Strain MR164] | ||
+ | | X | ||
+ | | [http://www.wormbase.org/db/get?name=Marker26;class=Expr_pattern Marker26] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00001250;class=Gene elt-2] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0005772;class=Anatomy_term intestine] | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00031534;class=Paper WBPaper00031534] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=rtIs11;class=Transgene rtIs11] | + | | [http://www.wormbase.org/db/get?name=rtIs11;class=Transgene rtIs11] |
+ | | [osm-10::gfp; osm-10::Htn-Q150]. An integration into chromosome V of the extrachromosomal array rtEx1, which contains pHA#16(osm-10::Htn_Q150), pDPY20, and pKP#58(osm-10::gfp). Htn-Q150 is huntingtin (Genbank no. L13292) with polyQ tracts of150 residues. | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=HA659;class=Strain HA659]<br>[http://www.wormbase.org/db/get?name=HA759;class=Strain HA759] | ||
+ | | V | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=rtIs18;class=Transgene rtIs18] | + | | [http://www.wormbase.org/db/get?name=rtIs18;class=Transgene rtIs18] |
+ | | [elt-2::gfp; osm-10::Htn-Q150]. rtIs18 is an integration into chromosome I of the extrachromosomal array rtEx362, which contains pHA#16 and elt-2::GFP. | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=HA661;class=Strain HA661] | ||
+ | | I | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=rtIs25;class=Transgene rtIs25] | + | | [http://www.wormbase.org/db/get?name=rtIs25;class=Transgene rtIs25] |
+ | | [sra-6::YC2.12] | ||
+ | | YC2.12 | ||
+ | | [http://www.wormbase.org/db/get?name=HA1203;class=Strain HA1203] | ||
+ | | X | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=ruIs1;class=Transgene ruIs1] | + | | [http://www.wormbase.org/db/get?name=ruIs1;class=Transgene ruIs1] |
+ | | [unc-119::unc-119+sup-7 suppressor tRNA gene] | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=AZ60;class=Strain AZ60] | ||
+ | | IV | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=ruIs10;class=Transgene ruIs10] | + | | [http://www.wormbase.org/db/get?name=ruIs10;class=Transgene ruIs10] |
+ | | [unc-119::unc-119+sup-7 suppressor tRNA gene] | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=AZ69;class=Strain AZ69] | ||
+ | | III | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=ruIs25;class=Transgene ruIs25] | + | | [http://www.wormbase.org/db/get?name=ruIs25;class=Transgene ruIs25] |
+ | | [unc-119::unc-119(+)] | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=AZ199;class=Strain AZ199] | ||
+ | | V | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=ruIs26;class=Transgene ruIs26] | + | | [http://www.wormbase.org/db/get?name=ruIs26;class=Transgene ruIs26] |
+ | | [unc-119::unc-119(+)] | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=AZ200;class=Strain AZ200] | ||
+ | | III | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=ruIs27;class=Transgene ruIs27] | + | | [http://www.wormbase.org/db/get?name=ruIs27;class=Transgene ruIs27] |
+ | | [unc-119::unc-119(+)] | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=AZ205;class=Strain AZ205] | ||
+ | | I | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=ruIs3;class=Transgene ruIs3] | + | | [http://www.wormbase.org/db/get?name=ruIs3;class=Transgene ruIs3] |
+ | | [unc-119::unc-119+sup-7 suppressor tRNA gene] | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=AZ62;class=Strain AZ62] | ||
+ | | IV | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=ruIs32;class=Transgene ruIs32] | + | | [http://www.wormbase.org/db/get?name=ruIs32;class=Transgene ruIs32] |
+ | | [pie-1::GFP-his-11, unc-119(+)] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=AZ212;class=Strain AZ212]<br>[http://www.wormbase.org/db/get?name=NL3847;class=Strain NL3847]<br>[http://www.wormbase.org/db/get?name=OC95;class=Strain OC95]<br>[http://www.wormbase.org/db/get?name=RW10006;class=Strain RW10006]<br>[http://www.wormbase.org/db/get?name=TH32;class=Strain TH32]<br>[http://www.wormbase.org/db/get?name=TY3558;class=Strain TY3558]<br>[http://www.wormbase.org/db/get?name=XA3501;class=Strain XA3501]<br>[http://www.wormbase.org/db/get?name=NL3630;class=Strain NL3630]<br>[http://www.wormbase.org/db/get?name=TH33;class=Strain TH33] | ||
+ | | III | ||
+ | | [http://www.wormbase.org/db/get?name=Marker76;class=Expr_pattern Marker76] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00001885;class=Gene his-11] | ||
+ | | | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00031431;class=Paper WBPaper00031431] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=ruIs33;class=Transgene ruIs33] | + | | [http://www.wormbase.org/db/get?name=ruIs33;class=Transgene ruIs33] |
+ | | [pie-1::GFP:H2B:pie-1]. Both unc-119::unc-119(+) injextion marker and pri-1::GFP are in the same plasmid pAZ132. | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=AZ213;class=Strain AZ213] | ||
+ | | V | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=ruIs34;class=Transgene ruIs34] | + | | [http://www.wormbase.org/db/get?name=ruIs34;class=Transgene ruIs34] |
+ | | [pie-1::GFP:H2B:pie-1]. Both unc-119::unc-119(+) injextion marker and pie-1::GFP are in the same plasmid pAZ132. | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=AZ214;class=Strain AZ214] | ||
+ | | I | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=ruIs37;class=Transgene ruIs37] | + | | [http://www.wormbase.org/db/get?name=ruIs37;class=Transgene ruIs37] |
+ | | [myo-2::GFP]. Both unc-119::unc-119(+) injextion marker and myo-2::GFP are in the same plasmid pAZ119. | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=AZ217;class=Strain AZ217] | ||
+ | | III | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=ruIs38;class=Transgene ruIs38] | + | | [http://www.wormbase.org/db/get?name=ruIs38;class=Transgene ruIs38] |
+ | | [myo-2::GFP]. Both unc-119::unc-119(+) injextion marker and myo-2::GFP are in the same plasmid pAZ119. | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=AZ218;class=Strain AZ218] | ||
+ | | III | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=ruIs59;class=Transgene ruIs59] | + | | [http://www.wormbase.org/db/get?name=ruIs59;class=Transgene ruIs59] |
+ | | [unc-119::unc-119(+)] | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=AZ173;class=Strain AZ173] | ||
+ | | III | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=saIs5;class=Transgene saIs5] | + | | [http://www.wormbase.org/db/get?name=saIs5;class=Transgene saIs5] |
+ | | [P10G10(+); pRF4] | ||
+ | | | ||
+ | | | ||
+ | | V | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=smIs1;class=Transgene smIs1] | + | | [http://www.wormbase.org/db/get?name=smIs1;class=Transgene smIs1] |
+ | | [mec-3::gfp; mec-7::mec-3]smIs1 was generated by integrating through exposure to gamma-rays an extrachromosomal array containing Pmec-7acCED-3(10mg/ml), Pmec-3GFP (10mg/ml1) and pL15EK (40mg/ml), a plasmid that rescues lin-15 mutant, into lin-15(n765ts) animals. It was then backcrossed six times with N2 animals and mapped to LGV. | ||
+ | | GFP | ||
+ | | | ||
+ | | V | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=smIs111;class=Transgene smIs111] | + | | [http://www.wormbase.org/db/get?name=smIs111;class=Transgene smIs111] |
+ | | [egl-1::acCED-3] | ||
+ | | | ||
+ | | | ||
+ | | X | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=smIs13;class=Transgene smIs13] || | + | | [http://www.wormbase.org/db/get?name=smIs13;class=Transgene smIs13] |
+ | | | ||
+ | | | ||
+ | | | ||
+ | | I | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=smIs23;class=Transgene smIs23] | + | | [http://www.wormbase.org/db/get?name=smIs23;class=Transgene smIs23] |
+ | | [pkd-2::gfp] | ||
+ | | GFP | ||
+ | | | ||
+ | | II | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=smIs26;class=Transgene smIs26] | + | | [http://www.wormbase.org/db/get?name=smIs26;class=Transgene smIs26] |
+ | | [pkd-2::gfp] | ||
+ | | GFP | ||
+ | | | ||
+ | | IV | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=smIs54;class=Transgene smIs54] | + | | [http://www.wormbase.org/db/get?name=smIs54;class=Transgene smIs54] |
+ | | [ceh-30::ceh-30-gfp] | ||
+ | | GFP | ||
+ | | | ||
+ | | X | ||
+ | | [http://www.wormbase.org/db/get?name=Expr7849;class=Expr_pattern Expr7849] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00000451;class=Gene ceh-30] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0004939;class=Anatomy_term CEMVR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004941;class=Anatomy_term CEMVL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004945;class=Anatomy_term CEMDL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004943;class=Anatomy_term CEMDR] | ||
+ | | [http://www.wormbase.org/db/get?name=embryo;class=Life_stage embryo]<br>[http://www.wormbase.org/db/get?name=L1%20larva;class=Life_stage L1 larva]<br>[http://www.wormbase.org/db/get?name=L2%20larva;class=Life_stage L2 larva]<br>[http://www.wormbase.org/db/get?name=L3%20larva;class=Life_stage L3 larva]<br>[http://www.wormbase.org/db/get?name=L4%20larva;class=Life_stage L4 larva]<br>[http://www.wormbase.org/db/get?name=adult;class=Life_stage adult] | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00031299;class=Paper WBPaper00031299] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=smIs76;class=Transgene smIs76] | + | | [http://www.wormbase.org/db/get?name=smIs76;class=Transgene smIs76] |
+ | | [PhspANV::GFP] | ||
+ | | GFP | ||
+ | | | ||
+ | | V | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=swIs1;class=Transgene swIs1] | + | | [http://www.wormbase.org/db/get?name=swIs1;class=Transgene swIs1] |
+ | | [rol-6(su1006); ceh-13::gfp] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=FR317;class=Strain FR317] | ||
+ | | II | ||
+ | | [http://www.wormbase.org/db/get?name=Expr513;class=Expr_pattern Expr513] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00000437;class=Gene ceh-13] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0006669;class=Anatomy_term ABplppp]<br>[http://www.wormbase.org/db/get?name=WBbt:0005772;class=Anatomy_term intestine]<br>[http://www.wormbase.org/db/get?name=WBbt:0006347;class=Anatomy_term ABprpp]<br>[http://www.wormbase.org/db/get?name=WBbt:0006000;class=Anatomy_term Epl]<br>[http://www.wormbase.org/db/get?name=WBbt:0006158;class=Anatomy_term ABprppp]<br>[http://www.wormbase.org/db/get?name=WBbt:0005936;class=Anatomy_term ABplapp]<br>[http://www.wormbase.org/db/get?name=WBbt:0005880;class=Anatomy_term ABprapp]<br>[http://www.wormbase.org/db/get?name=WBbt:0006512;class=Anatomy_term Da]<br>[http://www.wormbase.org/db/get?name=WBbt:0006741;class=Anatomy_term ABalppa]<br>[http://www.wormbase.org/db/get?name=WBbt:0006612;class=Anatomy_term Ep]<br>[http://www.wormbase.org/db/get?name=WBbt:0006652;class=Anatomy_term ABalapa]<br>[http://www.wormbase.org/db/get?name=WBbt:0006486;class=Anatomy_term ABalpp]<br>[http://www.wormbase.org/db/get?name=WBbt:0006501;class=Anatomy_term ABarppp]<br>[http://www.wormbase.org/db/get?name=WBbt:0005922;class=Anatomy_term ABprap]<br>[http://www.wormbase.org/db/get?name=WBbt:0006097;class=Anatomy_term ABprppa]<br>[http://www.wormbase.org/db/get?name=WBbt:0006250;class=Anatomy_term ABarppa]<br>[http://www.wormbase.org/db/get?name=WBbt:0005903;class=Anatomy_term ABarap]<br>[http://www.wormbase.org/db/get?name=WBbt:0006718;class=Anatomy_term Dp]<br>[http://www.wormbase.org/db/get?name=WBbt:0005946;class=Anatomy_term ABalapp]<br>[http://www.wormbase.org/db/get?name=WBbt:0006353;class=Anatomy_term ABplpp]<br>[http://www.wormbase.org/db/get?name=WBbt:0006101;class=Anatomy_term ABalap]<br>[http://www.wormbase.org/db/get?name=WBbt:0006328;class=Anatomy_term ABarapa]<br>[http://www.wormbase.org/db/get?name=WBbt:0006048;class=Anatomy_term ABalppp]<br>[http://www.wormbase.org/db/get?name=WBbt:0006192;class=Anatomy_term ABarapp]<br>[http://www.wormbase.org/db/get?name=WBbt:0006096;class=Anatomy_term ABplap]<br>[http://www.wormbase.org/db/get?name=WBbt:0006547;class=Anatomy_term Epr]<br>[http://www.wormbase.org/db/get?name=WBbt:0006579;class=Anatomy_term ABplppa]<br>[http://www.wormbase.org/db/get?name=WBbt:0006046;class=Anatomy_term ABarpp]<br>[http://www.wormbase.org/db/get?name=WBbt:0006367;class=Anatomy_term ABprapa]<br>[http://www.wormbase.org/db/get?name=WBbt:0005879;class=Anatomy_term ABplapa] | ||
+ | | [http://www.wormbase.org/db/get?name=blastula%20embryo;class=Life_stage blastula embryo] | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00002941;class=Paper WBPaper00002941] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=swIs1;class=Transgene swIs1] | + | | [http://www.wormbase.org/db/get?name=swIs1;class=Transgene swIs1] |
+ | | [rol-6(su1006); ceh-13::gfp] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=FR317;class=Strain FR317] | ||
+ | | II | ||
+ | | [http://www.wormbase.org/db/get?name=Expr1771;class=Expr_pattern Expr1771] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00000437;class=Gene ceh-13] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0006347;class=Anatomy_term ABprpp]<br>[http://www.wormbase.org/db/get?name=WBbt:0006162;class=Anatomy_term ABara]<br>[http://www.wormbase.org/db/get?name=WBbt:0006653;class=Anatomy_term ABarp]<br>[http://www.wormbase.org/db/get?name=WBbt:0005733;class=Anatomy_term hypodermis]<br>[http://www.wormbase.org/db/get?name=WBbt:0006581;class=Anatomy_term ABpra]<br>[http://www.wormbase.org/db/get?name=WBbt:0006341;class=Anatomy_term ABpla]<br>[http://www.wormbase.org/db/get?name=WBbt:0005757;class=Anatomy_term male-specific]<br>[http://www.wormbase.org/db/get?name=WBbt:0006612;class=Anatomy_term Ep]<br>[http://www.wormbase.org/db/get?name=WBbt:0006486;class=Anatomy_term ABalpp]<br>[http://www.wormbase.org/db/get?name=WBbt:0006707;class=Anatomy_term ABala]<br>[http://www.wormbase.org/db/get?name=WBbt:0005300;class=Anatomy_term ventral cord neuron]<br>[http://www.wormbase.org/db/get?name=WBbt:0006451;class=Anatomy_term ABprp]<br>[http://www.wormbase.org/db/get?name=WBbt:0005922;class=Anatomy_term ABprap]<br>[http://www.wormbase.org/db/get?name=WBbt:0005903;class=Anatomy_term ABarap]<br>[http://www.wormbase.org/db/get?name=WBbt:0006353;class=Anatomy_term ABplpp]<br>[http://www.wormbase.org/db/get?name=WBbt:0006101;class=Anatomy_term ABalap]<br>[http://www.wormbase.org/db/get?name=WBbt:0005813;class=Anatomy_term body wall musculature]<br>[http://www.wormbase.org/db/get?name=WBbt:0005865;class=Anatomy_term ABalp]<br>[http://www.wormbase.org/db/get?name=WBbt:0006096;class=Anatomy_term ABplap]<br>[http://www.wormbase.org/db/get?name=WBbt:0006279;class=Anatomy_term ABplp]<br>[http://www.wormbase.org/db/get?name=WBbt:0006046;class=Anatomy_term ABarpp] | ||
+ | | [http://www.wormbase.org/db/get?name=gastrulating%20embryo;class=Life_stage gastrulating embryo]<br>[http://www.wormbase.org/db/get?name=enclosing%20embryo;class=Life_stage enclosing embryo]<br>[http://www.wormbase.org/db/get?name=elongating%20embryo;class=Life_stage elongating embryo]<br>[http://www.wormbase.org/db/get?name=fully-elongated%20embryo;class=Life_stage fully-elongated embryo]<br>[http://www.wormbase.org/db/get?name=larva;class=Life_stage larva]<br>[http://www.wormbase.org/db/get?name=adult;class=Life_stage adult] | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00005094;class=Paper WBPaper00005094] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=swIs79;class=Transgene swIs79] | + | | [http://www.wormbase.org/db/get?name=swIs79;class=Transgene swIs79] |
+ | | [ajm-1::gfp, unc-119(+)] | ||
+ | | GFP | ||
+ | | | ||
+ | | IV | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=syIs1;class=Transgene syIs1] | + | | [http://www.wormbase.org/db/get?name=syIs1;class=Transgene syIs1] |
+ | | [lin-3(+)]. lin-3 and an unc-31 subclone with selective marker. | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=PS1123;class=Strain PS1123] | ||
+ | | X | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=syIs101;class=Transgene syIs101] | + | | [http://www.wormbase.org/db/get?name=syIs101;class=Transgene syIs101] |
+ | | [T04B2.6::yfp] | ||
+ | | YFP | ||
+ | | [http://www.wormbase.org/db/get?name=PS3722;class=Strain PS3722] | ||
+ | | IV | ||
+ | | [http://www.wormbase.org/db/get?name=Expr2358;class=Expr_pattern Expr2358] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00011424;class=Gene dhs-31] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0006766;class=Anatomy_term vulD]<br>[http://www.wormbase.org/db/get?name=WBbt:0006764;class=Anatomy_term vulB2]<br>[http://www.wormbase.org/db/get?name=WBbt:0006763;class=Anatomy_term vulB1] | ||
+ | | [http://www.wormbase.org/db/get?name=adult;class=Life_stage adult] | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00013312;class=Paper WBPaper00013312] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=syIs102;class=Transgene syIs102] | + | | [http://www.wormbase.org/db/get?name=syIs102;class=Transgene syIs102] |
+ | | [T04B2.6::cfp] | ||
+ | | CFP | ||
+ | | [http://www.wormbase.org/db/get?name=PS3724;class=Strain PS3724] | ||
+ | | X | ||
+ | | [http://www.wormbase.org/db/get?name=Expr2358;class=Expr_pattern Expr2358] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00011424;class=Gene dhs-31] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0006766;class=Anatomy_term vulD]<br>[http://www.wormbase.org/db/get?name=WBbt:0006764;class=Anatomy_term vulB2]<br>[http://www.wormbase.org/db/get?name=WBbt:0006763;class=Anatomy_term vulB1] | ||
+ | | [http://www.wormbase.org/db/get?name=adult;class=Life_stage adult] | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00013312;class=Paper WBPaper00013312] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=syIs118;class=Transgene syIs118] | + | | [http://www.wormbase.org/db/get?name=syIs118;class=Transgene syIs118] |
+ | | [fos-1a::YFP-TX] | ||
+ | | YFP | ||
+ | | [http://www.wormbase.org/db/get?name=PS4441;class=Strain PS4441] | ||
+ | | I | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=syIs12;class=Transgene syIs12] | + | | [http://www.wormbase.org/db/get?name=syIs12;class=Transgene syIs12] |
+ | | [hsLIN-3EGF; dpy-20(+)] | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=PS2037;class=Strain PS2037] | ||
+ | | II | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=syIs129;class=Transgene syIs129] | + | | [http://www.wormbase.org/db/get?name=syIs129;class=Transgene syIs129] |
+ | | [hemicentin-SP::GFP] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=PS4444;class=Strain PS4444] | ||
+ | | III | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=syIs137;class=Transgene syIs137] | + | | [http://www.wormbase.org/db/get?name=syIs137;class=Transgene syIs137] |
+ | | [fos-1b::CFP-TX] | ||
+ | | CFP | ||
+ | | [http://www.wormbase.org/db/get?name=PS4558;class=Strain PS4558] | ||
+ | | III | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=syIs17;class=Transgene syIs17] | + | | [http://www.wormbase.org/db/get?name=syIs17;class=Transgene syIs17] |
+ | | [hsp16-2::goa-1(Q205L); dpy-20(+)]. Integrated transgenic line of activated Goa under the control of hsp16-2 promoter. | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=PS1681;class=Strain PS1681]<br>[http://www.wormbase.org/db/get?name=PS3351;class=Strain PS3351] | ||
+ | | IV | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=syIs20;class=Transgene syIs20] | + | | [http://www.wormbase.org/db/get?name=syIs20;class=Transgene syIs20] |
+ | | [gpa-1::lacZ; dpy-20(+)] | ||
+ | | LacZ | ||
+ | | [http://www.wormbase.org/db/get?name=PS1702;class=Strain PS1702]<br>[http://www.wormbase.org/db/get?name=PS2767;class=Strain PS2767]<br>[http://www.wormbase.org/db/get?name=PS2943;class=Strain PS2943]<br>[http://www.wormbase.org/db/get?name=PS3170;class=Strain PS3170] | ||
+ | | V | ||
+ | | [http://www.wormbase.org/db/get?name=Expr522;class=Expr_pattern Expr522] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00001663;class=Gene gpa-1] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0004365;class=Anatomy_term PHAR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004966;class=Anatomy_term SPDL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004366;class=Anatomy_term PHAL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004965;class=Anatomy_term SPDR]<br>[http://www.wormbase.org/db/get?name=WBbt:0005739;class=Anatomy_term head]<br>[http://www.wormbase.org/db/get?name=WBbt:0005659;class=Anatomy_term PHBR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004364;class=Anatomy_term PHBL] | ||
+ | | [http://www.wormbase.org/db/get?name=adult;class=Life_stage adult] | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00003453;class=Paper WBPaper00003453] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=syIs25;class=Transgene syIs25] | + | | [http://www.wormbase.org/db/get?name=syIs25;class=Transgene syIs25] |
+ | | [gpa-3::gpa-3(QL)]. QL means a constitutive activating mutation. | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=PS2109;class=Strain PS2109] | ||
+ | | X | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=syIs49;class=Transgene syIs49] | + | | [http://www.wormbase.org/db/get?name=syIs49;class=Transgene syIs49] |
+ | | [zmp-1::gfp] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=PS3239;class=Strain PS3239] | ||
+ | | IV | ||
+ | | [http://www.wormbase.org/db/get?name=Expr1720;class=Expr_pattern Expr1720] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00006987;class=Gene zmp-1] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0004451;class=Anatomy_term vulval cell]<br>[http://www.wormbase.org/db/get?name=WBbt:0004522;class=Anatomy_term Anchor cell]<br>[http://www.wormbase.org/db/get?name=WBbt:0004454;class=Anatomy_term vulval cell]<br>[http://www.wormbase.org/db/get?name=WBbt:0004449;class=Anatomy_term vulval cell]<br>[http://www.wormbase.org/db/get?name=WBbt:0004452;class=Anatomy_term vulval cell]<br>[http://www.wormbase.org/db/get?name=WBbt:0004450;class=Anatomy_term vulval cell]<br>[http://www.wormbase.org/db/get?name=WBbt:0006767;class=Anatomy_term vulE]<br>[http://www.wormbase.org/db/get?name=WBbt:0004455;class=Anatomy_term vulval cell]<br>[http://www.wormbase.org/db/get?name=WBbt:0004456;class=Anatomy_term vulval cell]<br>[http://www.wormbase.org/db/get?name=WBbt:0004453;class=Anatomy_term vulval cell] | ||
+ | | [http://www.wormbase.org/db/get?name=L3%20larva;class=Life_stage L3 larva]<br>[http://www.wormbase.org/db/get?name=L4%20larva;class=Life_stage L4 larva]<br>[http://www.wormbase.org/db/get?name=adult;class=Life_stage adult] | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00004481;class=Paper WBPaper00004481] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=syIs49;class=Transgene syIs49] | + | | [http://www.wormbase.org/db/get?name=syIs49;class=Transgene syIs49] |
+ | | [zmp-1::gfp] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=PS3239;class=Strain PS3239] | ||
+ | | IV | ||
+ | | [http://www.wormbase.org/db/get?name=Expr2357;class=Expr_pattern Expr2357] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00006987;class=Gene zmp-1] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0006762;class=Anatomy_term vulA]<br>[http://www.wormbase.org/db/get?name=WBbt:0006767;class=Anatomy_term vulE]<br>[http://www.wormbase.org/db/get?name=WBbt:0006766;class=Anatomy_term vulD] | ||
+ | | [http://www.wormbase.org/db/get?name=L4%20larva;class=Life_stage L4 larva]<br>[http://www.wormbase.org/db/get?name=adult;class=Life_stage adult] | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00013312;class=Paper WBPaper00013312] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=syIs50;class=Transgene syIs50] | + | | [http://www.wormbase.org/db/get?name=syIs50;class=Transgene syIs50] |
+ | | [cdh-3::gfp] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=PS3352;class=Strain PS3352]<br>[http://www.wormbase.org/db/get?name=YG1007;class=Strain YG1007] | ||
+ | | X | ||
+ | | [http://www.wormbase.org/db/get?name=Expr2355;class=Expr_pattern Expr2355] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00000395;class=Gene cdh-3] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0006765;class=Anatomy_term vulC]<br>[http://www.wormbase.org/db/get?name=WBbt:0006768;class=Anatomy_term vulF]<br>[http://www.wormbase.org/db/get?name=WBbt:0006767;class=Anatomy_term vulE]<br>[http://www.wormbase.org/db/get?name=WBbt:0006766;class=Anatomy_term vulD] | ||
+ | | [http://www.wormbase.org/db/get?name=L4%20larva;class=Life_stage L4 larva]<br>[http://www.wormbase.org/db/get?name=adult;class=Life_stage adult] | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00013312;class=Paper WBPaper00013312] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=syIs51;class=Transgene syIs51] | + | | [http://www.wormbase.org/db/get?name=syIs51;class=Transgene syIs51] |
+ | | [cdh-3::cfp] | ||
+ | | CFP | ||
+ | | [http://www.wormbase.org/db/get?name=PS3475;class=Strain PS3475]<br>[http://www.wormbase.org/db/get?name=PS3528;class=Strain PS3528] | ||
+ | | V | ||
+ | | [http://www.wormbase.org/db/get?name=Expr2355;class=Expr_pattern Expr2355] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00000395;class=Gene cdh-3] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0006765;class=Anatomy_term vulC]<br>[http://www.wormbase.org/db/get?name=WBbt:0006768;class=Anatomy_term vulF]<br>[http://www.wormbase.org/db/get?name=WBbt:0006767;class=Anatomy_term vulE]<br>[http://www.wormbase.org/db/get?name=WBbt:0006766;class=Anatomy_term vulD] | ||
+ | | [http://www.wormbase.org/db/get?name=L4%20larva;class=Life_stage L4 larva]<br>[http://www.wormbase.org/db/get?name=adult;class=Life_stage adult] | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00013312;class=Paper WBPaper00013312] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=syIs52;class=Transgene syIs52] | + | | [http://www.wormbase.org/db/get?name=syIs52;class=Transgene syIs52] |
+ | | [cdh-3::cfp] | ||
+ | | CFP | ||
+ | | [http://www.wormbase.org/db/get?name=PS3476;class=Strain PS3476] | ||
+ | | X | ||
+ | | [http://www.wormbase.org/db/get?name=Expr2355;class=Expr_pattern Expr2355] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00000395;class=Gene cdh-3] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0006765;class=Anatomy_term vulC]<br>[http://www.wormbase.org/db/get?name=WBbt:0006768;class=Anatomy_term vulF]<br>[http://www.wormbase.org/db/get?name=WBbt:0006767;class=Anatomy_term vulE]<br>[http://www.wormbase.org/db/get?name=WBbt:0006766;class=Anatomy_term vulD] | ||
+ | | [http://www.wormbase.org/db/get?name=L4%20larva;class=Life_stage L4 larva]<br>[http://www.wormbase.org/db/get?name=adult;class=Life_stage adult] | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00013312;class=Paper WBPaper00013312] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=syIs54;class=Transgene syIs54] | + | | [http://www.wormbase.org/db/get?name=syIs54;class=Transgene syIs54] |
+ | | [ceh-2::gfp] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=PS3504;class=Strain PS3504]<br>[http://www.wormbase.org/db/get?name=PS3634;class=Strain PS3634]<br>[http://www.wormbase.org/db/get?name=PS5136;class=Strain PS5136] | ||
+ | | II | ||
+ | | [http://www.wormbase.org/db/get?name=Expr2356;class=Expr_pattern Expr2356] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00000429;class=Gene ceh-2] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0006765;class=Anatomy_term vulC]<br>[http://www.wormbase.org/db/get?name=WBbt:0006764;class=Anatomy_term vulB2]<br>[http://www.wormbase.org/db/get?name=WBbt:0006763;class=Anatomy_term vulB1] | ||
+ | | [http://www.wormbase.org/db/get?name=L4%20larva;class=Life_stage L4 larva]<br>[http://www.wormbase.org/db/get?name=adult;class=Life_stage adult] | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00013312;class=Paper WBPaper00013312] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=syIs55;class=Transgene syIs55] | + | | [http://www.wormbase.org/db/get?name=syIs55;class=Transgene syIs55] |
+ | | [ceh-2::yfp] | ||
+ | | YFP | ||
+ | | [http://www.wormbase.org/db/get?name=PS3528;class=Strain PS3528]<br>[http://www.wormbase.org/db/get?name=PS3505;class=Strain PS3505]<br>[http://www.wormbase.org/db/get?name=PS5419;class=Strain PS5419] | ||
+ | | X | ||
+ | | [http://www.wormbase.org/db/get?name=Expr2356;class=Expr_pattern Expr2356] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00000429;class=Gene ceh-2] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0006765;class=Anatomy_term vulC]<br>[http://www.wormbase.org/db/get?name=WBbt:0006764;class=Anatomy_term vulB2]<br>[http://www.wormbase.org/db/get?name=WBbt:0006763;class=Anatomy_term vulB1] | ||
+ | | [http://www.wormbase.org/db/get?name=L4%20larva;class=Life_stage L4 larva]<br>[http://www.wormbase.org/db/get?name=adult;class=Life_stage adult] | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00013312;class=Paper WBPaper00013312] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=syIs56;class=Transgene syIs56] | + | | [http://www.wormbase.org/db/get?name=syIs56;class=Transgene syIs56] |
+ | | [ceh-2::yfp] | ||
+ | | YFP | ||
+ | | [http://www.wormbase.org/db/get?name=PS3506;class=Strain PS3506] | ||
+ | | V | ||
+ | | [http://www.wormbase.org/db/get?name=Expr2356;class=Expr_pattern Expr2356] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00000429;class=Gene ceh-2] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0006765;class=Anatomy_term vulC]<br>[http://www.wormbase.org/db/get?name=WBbt:0006764;class=Anatomy_term vulB2]<br>[http://www.wormbase.org/db/get?name=WBbt:0006763;class=Anatomy_term vulB1] | ||
+ | | [http://www.wormbase.org/db/get?name=L4%20larva;class=Life_stage L4 larva]<br>[http://www.wormbase.org/db/get?name=adult;class=Life_stage adult] | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00013312;class=Paper WBPaper00013312] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=syIs57;class=Transgene syIs57] | + | | [http://www.wormbase.org/db/get?name=syIs57;class=Transgene syIs57] |
+ | | [cdh-3::cfp] | ||
+ | | CFP | ||
+ | | [http://www.wormbase.org/db/get?name=PS3517;class=Strain PS3517] | ||
+ | | X | ||
+ | | [http://www.wormbase.org/db/get?name=Expr2355;class=Expr_pattern Expr2355] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00000395;class=Gene cdh-3] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0006765;class=Anatomy_term vulC]<br>[http://www.wormbase.org/db/get?name=WBbt:0006768;class=Anatomy_term vulF]<br>[http://www.wormbase.org/db/get?name=WBbt:0006767;class=Anatomy_term vulE]<br>[http://www.wormbase.org/db/get?name=WBbt:0006766;class=Anatomy_term vulD] | ||
+ | | [http://www.wormbase.org/db/get?name=L4%20larva;class=Life_stage L4 larva]<br>[http://www.wormbase.org/db/get?name=adult;class=Life_stage adult] | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00013312;class=Paper WBPaper00013312] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=syIs59;class=Transgene syIs59] | + | | [http://www.wormbase.org/db/get?name=syIs59;class=Transgene syIs59] |
+ | | [egl-17::cfp] | ||
+ | | CFP | ||
+ | | [http://www.wormbase.org/db/get?name=PS3525;class=Strain PS3525] | ||
+ | | X | ||
+ | | [http://www.wormbase.org/db/get?name=Expr2354;class=Expr_pattern Expr2354] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00001185;class=Gene egl-17] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0006765;class=Anatomy_term vulC]<br>[http://www.wormbase.org/db/get?name=WBbt:0006768;class=Anatomy_term vulF]<br>[http://www.wormbase.org/db/get?name=WBbt:0006767;class=Anatomy_term vulE]<br>[http://www.wormbase.org/db/get?name=WBbt:0006766;class=Anatomy_term vulD] | ||
+ | | [http://www.wormbase.org/db/get?name=L3%20larva;class=Life_stage L3 larva]<br>[http://www.wormbase.org/db/get?name=L4%20larva;class=Life_stage L4 larva] | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00013312;class=Paper WBPaper00013312] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=syIs60;class=Transgene syIs60] | + | | [http://www.wormbase.org/db/get?name=syIs60;class=Transgene syIs60] |
+ | | [F47B8.6::gfp] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=PS3526;class=Strain PS3526] | ||
+ | | II | ||
+ | | [http://www.wormbase.org/db/get?name=Expr2360;class=Expr_pattern Expr2360] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00009807;class=Gene F47B8.6] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0006765;class=Anatomy_term vulC]<br>[http://www.wormbase.org/db/get?name=WBbt:0006768;class=Anatomy_term vulF]<br>[http://www.wormbase.org/db/get?name=WBbt:0006767;class=Anatomy_term vulE]<br>[http://www.wormbase.org/db/get?name=WBbt:0006766;class=Anatomy_term vulD] | ||
+ | | [http://www.wormbase.org/db/get?name=adult;class=Life_stage adult] | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00013312;class=Paper WBPaper00013312] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=syIs61;class=Transgene syIs61] | + | | [http://www.wormbase.org/db/get?name=syIs61;class=Transgene syIs61] |
+ | | [F47B8.6::gfp] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=PS3527;class=Strain PS3527] | ||
+ | | V | ||
+ | | [http://www.wormbase.org/db/get?name=Expr2360;class=Expr_pattern Expr2360] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00009807;class=Gene F47B8.6] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0006765;class=Anatomy_term vulC]<br>[http://www.wormbase.org/db/get?name=WBbt:0006768;class=Anatomy_term vulF]<br>[http://www.wormbase.org/db/get?name=WBbt:0006767;class=Anatomy_term vulE]<br>[http://www.wormbase.org/db/get?name=WBbt:0006766;class=Anatomy_term vulD] | ||
+ | | [http://www.wormbase.org/db/get?name=adult;class=Life_stage adult] | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00013312;class=Paper WBPaper00013312] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=syIs65;class=Transgene syIs65] | + | | [http://www.wormbase.org/db/get?name=syIs65;class=Transgene syIs65] |
+ | | [B0034.1::pes-10::gfp] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=PS3664;class=Strain PS3664] | ||
+ | | IV | ||
+ | | [http://www.wormbase.org/db/get?name=Expr2359;class=Expr_pattern Expr2359] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00015002;class=Gene B0034.1] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0006768;class=Anatomy_term vulF]<br>[http://www.wormbase.org/db/get?name=WBbt:0006767;class=Anatomy_term vulE] | ||
+ | | [http://www.wormbase.org/db/get?name=L4%20larva;class=Life_stage L4 larva]<br>[http://www.wormbase.org/db/get?name=adult;class=Life_stage adult] | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00013312;class=Paper WBPaper00013312] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=syIs66;class=Transgene syIs66] | + | | [http://www.wormbase.org/db/get?name=syIs66;class=Transgene syIs66] |
+ | | [B0034.1::pes-10::gfp] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=PS3665;class=Strain PS3665] | ||
+ | | II | ||
+ | | [http://www.wormbase.org/db/get?name=Expr2359;class=Expr_pattern Expr2359] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00015002;class=Gene B0034.1] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0006768;class=Anatomy_term vulF]<br>[http://www.wormbase.org/db/get?name=WBbt:0006767;class=Anatomy_term vulE] | ||
+ | | [http://www.wormbase.org/db/get?name=L4%20larva;class=Life_stage L4 larva]<br>[http://www.wormbase.org/db/get?name=adult;class=Life_stage adult] | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00013312;class=Paper WBPaper00013312] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=syIs67;class=Transgene syIs67] | + | | [http://www.wormbase.org/db/get?name=syIs67;class=Transgene syIs67] |
+ | | [zmp-1::pes-10::cfp] | ||
+ | | CFP | ||
+ | | [http://www.wormbase.org/db/get?name=PS3666;class=Strain PS3666] | ||
+ | | V | ||
+ | | [http://www.wormbase.org/db/get?name=Expr2357;class=Expr_pattern Expr2357] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00006987;class=Gene zmp-1] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0006762;class=Anatomy_term vulA]<br>[http://www.wormbase.org/db/get?name=WBbt:0006767;class=Anatomy_term vulE]<br>[http://www.wormbase.org/db/get?name=WBbt:0006766;class=Anatomy_term vulD] | ||
+ | | [http://www.wormbase.org/db/get?name=L4%20larva;class=Life_stage L4 larva]<br>[http://www.wormbase.org/db/get?name=adult;class=Life_stage adult] | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00013312;class=Paper WBPaper00013312] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=syIs68;class=Transgene syIs68] | + | | [http://www.wormbase.org/db/get?name=syIs68;class=Transgene syIs68] |
+ | | [zmp-1::pes-10::cfp] | ||
+ | | CFP | ||
+ | | [http://www.wormbase.org/db/get?name=PS3667;class=Strain PS3667] | ||
+ | | IV | ||
+ | | [http://www.wormbase.org/db/get?name=Expr2357;class=Expr_pattern Expr2357] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00006987;class=Gene zmp-1] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0006762;class=Anatomy_term vulA]<br>[http://www.wormbase.org/db/get?name=WBbt:0006767;class=Anatomy_term vulE]<br>[http://www.wormbase.org/db/get?name=WBbt:0006766;class=Anatomy_term vulD] | ||
+ | | [http://www.wormbase.org/db/get?name=L4%20larva;class=Life_stage L4 larva]<br>[http://www.wormbase.org/db/get?name=adult;class=Life_stage adult] | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00013312;class=Paper WBPaper00013312] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=syIs69;class=Transgene syIs69] | + | | [http://www.wormbase.org/db/get?name=syIs69;class=Transgene syIs69] |
+ | | [zmp-1::pes-10::cfp] | ||
+ | | CFP | ||
+ | | [http://www.wormbase.org/db/get?name=PS3668;class=Strain PS3668] | ||
+ | | V | ||
+ | | [http://www.wormbase.org/db/get?name=Expr2357;class=Expr_pattern Expr2357] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00006987;class=Gene zmp-1] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0006762;class=Anatomy_term vulA]<br>[http://www.wormbase.org/db/get?name=WBbt:0006767;class=Anatomy_term vulE]<br>[http://www.wormbase.org/db/get?name=WBbt:0006766;class=Anatomy_term vulD] | ||
+ | | [http://www.wormbase.org/db/get?name=L4%20larva;class=Life_stage L4 larva]<br>[http://www.wormbase.org/db/get?name=adult;class=Life_stage adult] | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00013312;class=Paper WBPaper00013312] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=syIs76;class=Transgene syIs76] | + | | [http://www.wormbase.org/db/get?name=syIs76;class=Transgene syIs76] |
+ | | [zmp-1::pes-10::cfp] | ||
+ | | CFP | ||
+ | | [http://www.wormbase.org/db/get?name=PS3721;class=Strain PS3721] | ||
+ | | IV | ||
+ | | [http://www.wormbase.org/db/get?name=Expr2357;class=Expr_pattern Expr2357] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00006987;class=Gene zmp-1] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0006762;class=Anatomy_term vulA]<br>[http://www.wormbase.org/db/get?name=WBbt:0006767;class=Anatomy_term vulE]<br>[http://www.wormbase.org/db/get?name=WBbt:0006766;class=Anatomy_term vulD] | ||
+ | | [http://www.wormbase.org/db/get?name=L4%20larva;class=Life_stage L4 larva]<br>[http://www.wormbase.org/db/get?name=adult;class=Life_stage adult] | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00013312;class=Paper WBPaper00013312] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=syIs77;class=Transgene syIs77] | + | | [http://www.wormbase.org/db/get?name=syIs77;class=Transgene syIs77] |
+ | | [zmp-1::pes-10::yfp] | ||
+ | | YFP | ||
+ | | [http://www.wormbase.org/db/get?name=PS3728;class=Strain PS3728]<br>[http://www.wormbase.org/db/get?name=PS3997;class=Strain PS3997] | ||
+ | | II | ||
+ | | [http://www.wormbase.org/db/get?name=Expr2357;class=Expr_pattern Expr2357] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00006987;class=Gene zmp-1] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0006762;class=Anatomy_term vulA]<br>[http://www.wormbase.org/db/get?name=WBbt:0006767;class=Anatomy_term vulE]<br>[http://www.wormbase.org/db/get?name=WBbt:0006766;class=Anatomy_term vulD] | ||
+ | | [http://www.wormbase.org/db/get?name=L4%20larva;class=Life_stage L4 larva]<br>[http://www.wormbase.org/db/get?name=adult;class=Life_stage adult] | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00013312;class=Paper WBPaper00013312] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=syIs80;class=Transgene syIs80] | + | | [http://www.wormbase.org/db/get?name=syIs80;class=Transgene syIs80] |
+ | | [lin-11::gfp; unc-119(+)] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=DY164;class=Strain DY164]<br>[http://www.wormbase.org/db/get?name=PS3808;class=Strain PS3808] | ||
+ | | III | ||
+ | | [http://www.wormbase.org/db/get?name=Expr2574;class=Expr_pattern Expr2574] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00003000;class=Gene lin-11] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0006765;class=Anatomy_term vulC]<br>[http://www.wormbase.org/db/get?name=WBbt:0006751;class=Anatomy_term head neuron]<br>[http://www.wormbase.org/db/get?name=WBbt:0004811;class=Anatomy_term proct]<br>[http://www.wormbase.org/db/get?name=WBbt:0005300;class=Anatomy_term ventral cord neuron]<br>[http://www.wormbase.org/db/get?name=WBbt:0006762;class=Anatomy_term vulA]<br>[http://www.wormbase.org/db/get?name=WBbt:0006784;class=Anatomy_term uterine toroidal epithelial cell]<br>[http://www.wormbase.org/db/get?name=WBbt:0006768;class=Anatomy_term vulF]<br>[http://www.wormbase.org/db/get?name=WBbt:0006767;class=Anatomy_term vulE]<br>[http://www.wormbase.org/db/get?name=WBbt:0006766;class=Anatomy_term vulD]<br>[http://www.wormbase.org/db/get?name=WBbt:0006764;class=Anatomy_term vulB2]<br>[http://www.wormbase.org/db/get?name=WBbt:0006759;class=Anatomy_term tail neuron]<br>[http://www.wormbase.org/db/get?name=WBbt:0006763;class=Anatomy_term vulB1] | ||
+ | | [http://www.wormbase.org/db/get?name=L4%20larva;class=Life_stage L4 larva]<br>[http://www.wormbase.org/db/get?name=adult;class=Life_stage adult] | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00005954;class=Paper WBPaper00005954] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=syIs802;class=Transgene syIs802] | + | | [http://www.wormbase.org/db/get?name=syIs802;class=Transgene syIs802] |
+ | | [myo-2::GFP] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=PS9391;class=Strain PS9391] | ||
+ | | X | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=syIs803;class=Transgene syIs803] | + | | [http://www.wormbase.org/db/get?name=syIs803;class=Transgene syIs803] |
+ | | [myo-2:gfp, daf-4(+)] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=PS9392;class=Strain PS9392] | ||
+ | | II | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=syIs804;class=Transgene syIs804] | + | | [http://www.wormbase.org/db/get?name=syIs804;class=Transgene syIs804] |
+ | | [myo-2:gfp, daf-4(+)] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=PS9393;class=Strain PS9393] | ||
+ | | X | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=syIs807;class=Transgene syIs807] | + | | [http://www.wormbase.org/db/get?name=syIs807;class=Transgene syIs807] |
+ | | [myo-2:gfp, daf-4(+)] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=PS9396;class=Strain PS9396] | ||
+ | | IV | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=syIs90;class=Transgene syIs90] | + | | [http://www.wormbase.org/db/get?name=syIs90;class=Transgene syIs90] |
+ | | [egl-17::yfp] | ||
+ | | YFP | ||
+ | | [http://www.wormbase.org/db/get?name=PS3972;class=Strain PS3972] | ||
+ | | III | ||
+ | | [http://www.wormbase.org/db/get?name=Expr2354;class=Expr_pattern Expr2354] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00001185;class=Gene egl-17] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0006765;class=Anatomy_term vulC]<br>[http://www.wormbase.org/db/get?name=WBbt:0006768;class=Anatomy_term vulF]<br>[http://www.wormbase.org/db/get?name=WBbt:0006767;class=Anatomy_term vulE]<br>[http://www.wormbase.org/db/get?name=WBbt:0006766;class=Anatomy_term vulD] | ||
+ | | [http://www.wormbase.org/db/get?name=L3%20larva;class=Life_stage L3 larva]<br>[http://www.wormbase.org/db/get?name=L4%20larva;class=Life_stage L4 larva] | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00013312;class=Paper WBPaper00013312] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=syIs91;class=Transgene syIs91] | + | | [http://www.wormbase.org/db/get?name=syIs91;class=Transgene syIs91] |
+ | | [egl-17::yfp] | ||
+ | | YFP | ||
+ | | [http://www.wormbase.org/db/get?name=PS3973;class=Strain PS3973] | ||
+ | | III | ||
+ | | [http://www.wormbase.org/db/get?name=Expr2354;class=Expr_pattern Expr2354] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00001185;class=Gene egl-17] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0006765;class=Anatomy_term vulC]<br>[http://www.wormbase.org/db/get?name=WBbt:0006768;class=Anatomy_term vulF]<br>[http://www.wormbase.org/db/get?name=WBbt:0006767;class=Anatomy_term vulE]<br>[http://www.wormbase.org/db/get?name=WBbt:0006766;class=Anatomy_term vulD] | ||
+ | | [http://www.wormbase.org/db/get?name=L3%20larva;class=Life_stage L3 larva]<br>[http://www.wormbase.org/db/get?name=L4%20larva;class=Life_stage L4 larva] | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00013312;class=Paper WBPaper00013312] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=syIs99;class=Transgene syIs99] | + | | [http://www.wormbase.org/db/get?name=syIs99;class=Transgene syIs99] |
+ | | [egl-17::yfp] | ||
+ | | YFP | ||
+ | | [http://www.wormbase.org/db/get?name=PS4135;class=Strain PS4135] | ||
+ | | II | ||
+ | | [http://www.wormbase.org/db/get?name=Expr2354;class=Expr_pattern Expr2354] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00001185;class=Gene egl-17] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0006765;class=Anatomy_term vulC]<br>[http://www.wormbase.org/db/get?name=WBbt:0006768;class=Anatomy_term vulF]<br>[http://www.wormbase.org/db/get?name=WBbt:0006767;class=Anatomy_term vulE]<br>[http://www.wormbase.org/db/get?name=WBbt:0006766;class=Anatomy_term vulD] | ||
+ | | [http://www.wormbase.org/db/get?name=L3%20larva;class=Life_stage L3 larva]<br>[http://www.wormbase.org/db/get?name=L4%20larva;class=Life_stage L4 larva] | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00013312;class=Paper WBPaper00013312] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=teIs18;class=Transgene teIs18] | + | | [http://www.wormbase.org/db/get?name=teIs18;class=Transgene teIs18] |
+ | | [sdz-23::gfp-H2B] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=TX585;class=Strain TX585] | ||
+ | | V | ||
+ | | [http://www.wormbase.org/db/get?name=Expr3643;class=Expr_pattern Expr3643] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00019066;class=Gene sdz-23] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0006733;class=Anatomy_term Ea]<br>[http://www.wormbase.org/db/get?name=WBbt:0006612;class=Anatomy_term Ep]<br>[http://www.wormbase.org/db/get?name=WBbt:0004804;class=Anatomy_term E] | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00026704;class=Paper WBPaper00026704] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=teIs3;class=Transgene teIs3] | + | | [http://www.wormbase.org/db/get?name=teIs3;class=Transgene teIs3] |
+ | | [med-1::gfp-pop-1] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=TX300;class=Strain TX300]<br>[http://www.wormbase.org/db/get?name=TX932;class=Strain TX932] | ||
+ | | I | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=teIs46;class=Transgene teIs46] | + | | [http://www.wormbase.org/db/get?name=teIs46;class=Transgene teIs46] |
+ | | [end-1::gfp-H2B] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=TX691;class=Strain TX691] | ||
+ | | IV | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=tnIs13;class=Transgene tnIs13] | + | | [http://www.wormbase.org/db/get?name=tnIs13;class=Transgene tnIs13] |
+ | | [pie-1::vab-1::gfp; unc-119(+)] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=DG2102;class=Strain DG2102]<br>[http://www.wormbase.org/db/get?name=DG2160;class=Strain DG2160]<br>[http://www.wormbase.org/db/get?name=DG2189;class=Strain DG2189]<br>[http://www.wormbase.org/db/get?name=DG2190;class=Strain DG2190] | ||
+ | | V | ||
+ | | [http://www.wormbase.org/db/get?name=Expr8095;class=Expr_pattern Expr8095] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00006868;class=Gene vab-1] | ||
+ | | | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00031867;class=Paper WBPaper00031867] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=trIs30;class=Transgene trIs30] | + | | [http://www.wormbase.org/db/get?name=trIs30;class=Transgene trIs30] |
+ | | [(him-4p::MB::YFP; hmr-1b::DsRed2; unc-129neural-specific promoter::DsRed2]. RP247 trIs30 I was constructed by microinjecting pPRRF138.2(him-4p::MB::YFP), pPRZL44(hmr-1b::DsRed2) and pPR2.1(unc-129neural-specific promoter::DsRed2) together at 10, 80 and 40 ng/ul, respectively, into N2 (wild-type) adults. | ||
+ | | YFP, DsRed2 | ||
+ | | [http://www.wormbase.org/db/get?name=RP247;class=Strain RP247] | ||
+ | | I | ||
+ | | [http://www.wormbase.org/db/get?name=Marker8;class=Expr_pattern Marker8] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00001863;class=Gene him-4] | ||
+ | | | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00025227;class=Paper WBPaper00025227] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=tyIs4;class=Transgene tyIs4] | + | | [http://www.wormbase.org/db/get?name=tyIs4;class=Transgene tyIs4] |
+ | | [egl-13::gfp] transcriptional fusion. A strain containing the tyIs4 integrated chromosomal array was generated by injecting an egl-13::GFP transcriptional gene fusion (pWH17) into N2 and subjecting transmitting extra-chromosomal lines to gamma-irradiation; homozygous integrants were then selected. tyIs4 was mapped to chromosome III. | ||
+ | | GFP | ||
+ | | | ||
+ | | III | ||
+ | | [http://www.wormbase.org/db/get?name=Expr4977;class=Expr_pattern Expr4977] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00001182;class=Gene egl-13] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0006789;class=Anatomy_term uterine seam cell] | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00031111;class=Paper WBPaper00031111] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=uIs10;class=Transgene uIs10] | + | | [http://www.wormbase.org/db/get?name=uIs10;class=Transgene uIs10] |
+ | | [mec-9::lacZ] | ||
+ | | LacZ | ||
+ | | | ||
+ | | X | ||
+ | | [http://www.wormbase.org/db/get?name=Expr268;class=Expr_pattern Expr268] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00003173;class=Gene mec-9] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0004088;class=Anatomy_term PVDR]<br>[http://www.wormbase.org/db/get?name=WBbt:0005237;class=Anatomy_term touch receptor neuron]<br>[http://www.wormbase.org/db/get?name=WBbt:0004090;class=Anatomy_term PVDL]<br>[http://www.wormbase.org/db/get?name=WBbt:0006751;class=Anatomy_term head neuron]<br>[http://www.wormbase.org/db/get?name=WBbt:0005300;class=Anatomy_term ventral cord neuron] | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00002379;class=Paper WBPaper00002379] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=uIs22;class=Transgene uIs22] | + | | [http://www.wormbase.org/db/get?name=uIs22;class=Transgene uIs22] |
+ | | [mec-3::gfp] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=TU2562;class=Strain TU2562] | ||
+ | | V | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=uIs5;class=Transgene uIs5] | + | | [http://www.wormbase.org/db/get?name=uIs5;class=Transgene uIs5] |
+ | | [deg-1::lacZ] | ||
+ | | LacZ | ||
+ | | | ||
+ | | X | ||
+ | | [http://www.wormbase.org/db/get?name=Expr223;class=Expr_pattern Expr223] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00000950;class=Gene deg-1] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0004292;class=Anatomy_term anal depressor muscle]<br>[http://www.wormbase.org/db/get?name=WBbt:0005119;class=Anatomy_term IL1 neuron]<br>[http://www.wormbase.org/db/get?name=WBbt:0004094;class=Anatomy_term PVCL]<br>[http://www.wormbase.org/db/get?name=WBbt:0003866;class=Anatomy_term AVDL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004092;class=Anatomy_term PVCR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003865;class=Anatomy_term AVDR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003850;class=Anatomy_term AVG]<br>[http://www.wormbase.org/db/get?name=WBbt:0005813;class=Anatomy_term body wall musculature] | ||
+ | | [http://www.wormbase.org/db/get?name=all%20stages;class=Life_stage all stages] | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00002711;class=Paper WBPaper00002711] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=uIs6;class=Transgene uIs6] | + | | [http://www.wormbase.org/db/get?name=uIs6;class=Transgene uIs6] |
+ | | [deg-1::lacZ] | ||
+ | | LacZ | ||
+ | | | ||
+ | | X | ||
+ | | [http://www.wormbase.org/db/get?name=Expr223;class=Expr_pattern Expr223] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00000950;class=Gene deg-1] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0004292;class=Anatomy_term anal depressor muscle]<br>[http://www.wormbase.org/db/get?name=WBbt:0005119;class=Anatomy_term IL1 neuron]<br>[http://www.wormbase.org/db/get?name=WBbt:0004094;class=Anatomy_term PVCL]<br>[http://www.wormbase.org/db/get?name=WBbt:0003866;class=Anatomy_term AVDL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004092;class=Anatomy_term PVCR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003865;class=Anatomy_term AVDR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003850;class=Anatomy_term AVG]<br>[http://www.wormbase.org/db/get?name=WBbt:0005813;class=Anatomy_term body wall musculature] | ||
+ | | [http://www.wormbase.org/db/get?name=all%20stages;class=Life_stage all stages] | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00002711;class=Paper WBPaper00002711] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=uIs9;class=Transgene uIs9] | + | | [http://www.wormbase.org/db/get?name=uIs9;class=Transgene uIs9] |
+ | | [mec-2::gfp] | ||
+ | | GFP | ||
+ | | | ||
+ | | V | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=urIs13;class=Transgene urIs13] | + | | [http://www.wormbase.org/db/get?name=urIs13;class=Transgene urIs13] |
+ | | [unc-119::gfp; pRF4]. IM#175 is the plasmid construct of unc-119::gfp. | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=IM19;class=Strain IM19]<br>[http://www.wormbase.org/db/get?name=IM39;class=Strain IM39]<br>[http://www.wormbase.org/db/get?name=IM65;class=Strain IM65]<br>[http://www.wormbase.org/db/get?name=IM167;class=Strain IM167]<br>[http://www.wormbase.org/db/get?name=IM62;class=Strain IM62]<br>[http://www.wormbase.org/db/get?name=IM98;class=Strain IM98]<br>[http://www.wormbase.org/db/get?name=IM146;class=Strain IM146]<br>[http://www.wormbase.org/db/get?name=IM117;class=Strain IM117] | ||
+ | | IV | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=veIs13;class=Transgene veIs13] | + | | [http://www.wormbase.org/db/get?name=veIs13;class=Transgene veIs13] |
+ | | [col-19::gfp]. Integrated transgenic line containing translational fusion of col-19 first 7 amino acids with GFP. | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=RG365;class=Strain RG365]<br>[http://www.wormbase.org/db/get?name=GR1429;class=Strain GR1429]<br>[http://www.wormbase.org/db/get?name=GR1444;class=Strain GR1444]<br>[http://www.wormbase.org/db/get?name=GR1445;class=Strain GR1445] | ||
+ | | V | ||
+ | | [http://www.wormbase.org/db/get?name=Expr508;class=Expr_pattern Expr508] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00000608;class=Gene col-19] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0005733;class=Anatomy_term hypodermis] | ||
+ | | [http://www.wormbase.org/db/get?name=adult;class=Life_stage adult] | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00003119;class=Paper WBPaper00003119] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=vsIs103;class=Transgene vsIs103] | + | | [http://www.wormbase.org/db/get?name=vsIs103;class=Transgene vsIs103] |
+ | | [HSN::SNB-1-GFP-DsRed2] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=LX967;class=Strain LX967]<br>[http://www.wormbase.org/db/get?name=LX998;class=Strain LX998] | ||
+ | | X | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=vsIs108;class=Transgene vsIs108] | + | | [http://www.wormbase.org/db/get?name=vsIs108;class=Transgene vsIs108] |
+ | | [HSN::UNC-13S-GFP-DsRed2] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=LX993;class=Strain LX993] | ||
+ | | III | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=vsIs13;class=Transgene vsIs13] | + | | [http://www.wormbase.org/db/get?name=vsIs13;class=Transgene vsIs13] |
+ | | [pes-10::gfp]. A 500 bp VC enhancer fragment from lin-11 amplified by the primers 5 -GACCGCATGCGTGGTGTAATCTGATCTG and 5'-GAGAAGGCCTTGCTCTATTCAATCATCC cloned upstream of the basal pes-10 promoter and the GFP coding sequences in the vector pPD97.78 vector. | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=LX959;class=Strain LX959] | ||
+ | | IV | ||
+ | | [http://www.wormbase.org/db/get?name=Marker4;class=Expr_pattern Marker4] | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0005304;class=Anatomy_term VC neuron] | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00006049;class=Paper WBPaper00006049] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=vsIs49;class=Transgene vsIs49] | + | | [http://www.wormbase.org/db/get?name=vsIs49;class=Transgene vsIs49] |
+ | | [HSN::GOA-1(Q205L)] | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=LX940;class=Strain LX940] | ||
+ | | V | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=vsIs50;class=Transgene vsIs50] | + | | [http://www.wormbase.org/db/get?name=vsIs50;class=Transgene vsIs50] |
+ | | [HSN::S1 subunit of PTX] | ||
+ | | S1 subunit of PTX | ||
+ | | [http://www.wormbase.org/db/get?name=LX850;class=Strain LX850] | ||
+ | | X | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=vsIs56;class=Transgene vsIs56] | + | | [http://www.wormbase.org/db/get?name=vsIs56;class=Transgene vsIs56] |
+ | | [HSN::EGL-30(Q205L)] | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=LX895;class=Strain LX895]<br>[http://www.wormbase.org/db/get?name=LX884;class=Strain LX884] | ||
+ | | X | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=vtIs1;class=Transgene vtIs1] | + | | [http://www.wormbase.org/db/get?name=vtIs1;class=Transgene vtIs1] |
+ | | [dat-1::gfp; rol-6] transcriptional fusion. | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=OH4041;class=Strain OH4041]<br>[http://www.wormbase.org/db/get?name=OH4224;class=Strain OH4224]<br>[http://www.wormbase.org/db/get?name=OH4247;class=Strain OH4247]<br>[http://www.wormbase.org/db/get?name=OH4254;class=Strain OH4254]<br>[http://www.wormbase.org/db/get?name=OH4265;class=Strain OH4265]<br>[http://www.wormbase.org/db/get?name=OH4271;class=Strain OH4271]<br>[http://www.wormbase.org/db/get?name=OH4274;class=Strain OH4274]<br>[http://www.wormbase.org/db/get?name=OH4276;class=Strain OH4276]<br>[http://www.wormbase.org/db/get?name=OH4299;class=Strain OH4299]<br>[http://www.wormbase.org/db/get?name=OH4303;class=Strain OH4303]<br>[http://www.wormbase.org/db/get?name=OH4305;class=Strain OH4305]<br>[http://www.wormbase.org/db/get?name=OH4306;class=Strain OH4306]<br>[http://www.wormbase.org/db/get?name=OH4307;class=Strain OH4307]<br>[http://www.wormbase.org/db/get?name=OH4320;class=Strain OH4320]<br>[http://www.wormbase.org/db/get?name=OH4334;class=Strain OH4334]<br>[http://www.wormbase.org/db/get?name=OH4335;class=Strain OH4335]<br>[http://www.wormbase.org/db/get?name=OH4339;class=Strain OH4339]<br>[http://www.wormbase.org/db/get?name=OH6071;class=Strain OH6071]<br>[http://www.wormbase.org/db/get?name=OH6072;class=Strain OH6072]<br>[http://www.wormbase.org/db/get?name=OH6086;class=Strain OH6086]<br>[http://www.wormbase.org/db/get?name=OH6087;class=Strain OH6087]<br>[http://www.wormbase.org/db/get?name=OH7007;class=Strain OH7007]<br>[http://www.wormbase.org/db/get?name=OH7016;class=Strain OH7016]<br>[http://www.wormbase.org/db/get?name=OH7058;class=Strain OH7058]<br>[http://www.wormbase.org/db/get?name=OH7095;class=Strain OH7095]<br>[http://www.wormbase.org/db/get?name=OH7098;class=Strain OH7098]<br>[http://www.wormbase.org/db/get?name=OH7118;class=Strain OH7118]<br>[http://www.wormbase.org/db/get?name=OH7150;class=Strain OH7150]<br>[http://www.wormbase.org/db/get?name=OH7323;class=Strain OH7323]<br>[http://www.wormbase.org/db/get?name=BY200;class=Strain BY200] | ||
+ | | V | ||
+ | | [http://www.wormbase.org/db/get?name=Marker1;class=Expr_pattern Marker1] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00000934;class=Gene dat-1] | ||
+ | | | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00005147;class=Paper WBPaper00005147] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=wIs1;class=Transgene wIs1] | + | | [http://www.wormbase.org/db/get?name=wIs1;class=Transgene wIs1] |
+ | | [SCM::nls-lacZ; rol-6(su1006)] Seam cell specific promoter driving LacZ expression. | ||
+ | | LacZ | ||
+ | | [http://www.wormbase.org/db/get?name=JR125;class=Strain JR125] | ||
+ | | IV | ||
+ | | [http://www.wormbase.org/db/get?name=Marker23;class=Expr_pattern Marker23] | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0005753;class=Anatomy_term seam cell] | ||
+ | | [http://www.wormbase.org/db/get?name=embryo;class=Life_stage embryo] | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00002772;class=Paper WBPaper00002772] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=wIs54;class=Transgene wIs54] | + | | [http://www.wormbase.org/db/get?name=wIs54;class=Transgene wIs54] |
+ | | [ajm-1::gfp] seam cell specific promoter drives GFP expression. | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=JR672;class=Strain JR672]<br>[http://www.wormbase.org/db/get?name=GR1430;class=Strain GR1430]<br>[http://www.wormbase.org/db/get?name=GR1434;class=Strain GR1434]<br>[http://www.wormbase.org/db/get?name=GR1435;class=Strain GR1435]<br>[http://www.wormbase.org/db/get?name=GR1425;class=Strain GR1425] | ||
+ | | V | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=wIs78;class=Transgene wIs78] | + | | [http://www.wormbase.org/db/get?name=wIs78;class=Transgene wIs78] |
+ | | [ajm-1::gfp; scm-1::gfp; unc-119(+); F58E10(+)] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=JR1000;class=Strain JR1000]<br>[http://www.wormbase.org/db/get?name=RG733;class=Strain RG733]<br>[http://www.wormbase.org/db/get?name=RG734;class=Strain RG734] | ||
+ | | X | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=wIs84;class=Transgene wIs84] | + | | [http://www.wormbase.org/db/get?name=wIs84;class=Transgene wIs84] |
+ | | [elt-2::gfp] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=JR1130;class=Strain JR1130]<br>[http://www.wormbase.org/db/get?name=JR1838;class=Strain JR1838] | ||
+ | | X | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=wdIs1;class=Transgene wdIs1] | + | | [http://www.wormbase.org/db/get?name=wdIs1;class=Transgene wdIs1] |
+ | | [unc-4::lacZ] | ||
+ | | LacZ | ||
+ | | | ||
+ | | III | ||
+ | | [http://www.wormbase.org/db/get?name=Expr337;class=Expr_pattern Expr337] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00006744;class=Gene unc-4] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0005658;class=Anatomy_term AVFR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004740;class=Anatomy_term I5]<br>[http://www.wormbase.org/db/get?name=WBbt:0005278;class=Anatomy_term DA neuron]<br>[http://www.wormbase.org/db/get?name=WBbt:0005304;class=Anatomy_term VC neuron]<br>[http://www.wormbase.org/db/get?name=WBbt:0005657;class=Anatomy_term AVFL]<br>[http://www.wormbase.org/db/get?name=WBbt:0005396;class=Anatomy_term SAB]<br>[http://www.wormbase.org/db/get?name=WBbt:0005339;class=Anatomy_term VA neuron] | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00002281;class=Paper WBPaper00002281] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=wdIs3;class=Transgene wdIs3] | + | | [http://www.wormbase.org/db/get?name=wdIs3;class=Transgene wdIs3] |
+ | | [del-1::gfp] | ||
+ | | GFP | ||
+ | | | ||
+ | | X | ||
+ | | [http://www.wormbase.org/db/get?name=Expr2330;class=Expr_pattern Expr2330] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00000952;class=Gene del-1] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0004997;class=Anatomy_term SABVR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004643;class=Anatomy_term VB1]<br>[http://www.wormbase.org/db/get?name=WBbt:0004641;class=Anatomy_term VB2]<br>[http://www.wormbase.org/db/get?name=WBbt:0004998;class=Anatomy_term SABVL]<br>[http://www.wormbase.org/db/get?name=WBbt:0005339;class=Anatomy_term VA neuron] | ||
+ | | [http://www.wormbase.org/db/get?name=L2%20larva;class=Life_stage L2 larva]<br>[http://www.wormbase.org/db/get?name=L3%20larva;class=Life_stage L3 larva]<br>[http://www.wormbase.org/db/get?name=L4%20larva;class=Life_stage L4 larva]<br>[http://www.wormbase.org/db/get?name=adult;class=Life_stage adult] | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00003757;class=Paper WBPaper00003757] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=wxIs29;class=Transgene wxIs29] | + | | [http://www.wormbase.org/db/get?name=wxIs29;class=Transgene wxIs29] |
+ | | [ram-5::gfp, rol-6(su1006)] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=KC69;class=Strain KC69] | ||
+ | | I | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=yIs16;class=Transgene yIs16] | + | | [http://www.wormbase.org/db/get?name=yIs16;class=Transgene yIs16] |
+ | | [hsp::sdc-3(+)], transcriptional fusion, provide sdc-3 transcripts upon heat shock. | ||
+ | | | ||
+ | | | ||
+ | | X | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=yIs19;class=Transgene yIs19] | + | | [http://www.wormbase.org/db/get?name=yIs19;class=Transgene yIs19] |
+ | | [sdc-3::lacZ], transcriptional fusion, balancer for sdc-2. | ||
+ | | LacZ | ||
+ | | | ||
+ | | X | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=yIs2;class=Transgene yIs2] | + | | [http://www.wormbase.org/db/get?name=yIs2;class=Transgene yIs2] |
+ | | [xol-1::lacZ]. Translational fusion. | ||
+ | | LacZ | ||
+ | | [http://www.wormbase.org/db/get?name=TY1774;class=Strain TY1774]<br>[http://www.wormbase.org/db/get?name=TY1775;class=Strain TY1775] | ||
+ | | IV | ||
+ | | [http://www.wormbase.org/db/get?name=Expr1540;class=Expr_pattern Expr1540] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00006962;class=Gene xol-1] | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=gastrulating%20embryo;class=Life_stage gastrulating embryo]<br>[http://www.wormbase.org/db/get?name=enclosing%20embryo;class=Life_stage enclosing embryo]<br>[http://www.wormbase.org/db/get?name=bean%20embryo;class=Life_stage bean embryo]<br>[http://www.wormbase.org/db/get?name=comma%20embryo;class=Life_stage comma embryo] | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00002107;class=Paper WBPaper00002107] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=yIs29;class=Transgene yIs29] | + | | [http://www.wormbase.org/db/get?name=yIs29;class=Transgene yIs29] |
+ | | [dpy-30::sdc-2]. To create the dpy-30::sdc-2 transgene, a BglII site we introduced at the fourth codon of sdc-2 and an 11-kb BglIIKpnI sdc-2 fragment was subcloned into the Bcl I and Kpn I sites of pTY647, a plasmid containing the dpy-30 minimal rescuing region. The resulting transgene, pTY975, included the dpy-30 promoter, the first three codons of dpy-30, a leucine codon, and the entire sdc-2 structural gene beginning with its fifth codon. pTY975 was then injected with the transformation marker p76-16B [unc-76(+)]into him-8(e1489); unc-76 hermaphrodites and established transmitting lines. Extrachromosomal arrays bearing pTY975 were stably integrated into the genome by Gamma-irradiation for 15 min. Five independent integrated lines were isolated, including yIs29 on X and yIs30. | ||
+ | | | ||
+ | | | ||
+ | | X | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=yIs3;class=Transgene yIs3] | + | | [http://www.wormbase.org/db/get?name=yIs3;class=Transgene yIs3] |
+ | | [HA::SDC-3], provide excess sdc-3. | ||
+ | | | ||
+ | | | ||
+ | | V | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=yIs33;class=Transgene yIs33] | + | | [http://www.wormbase.org/db/get?name=yIs33;class=Transgene yIs33] |
+ | | [xol-1::lacZ] | ||
+ | | LacZ | ||
+ | | [http://www.wormbase.org/db/get?name=TY2438;class=Strain TY2438]<br>[http://www.wormbase.org/db/get?name=TY2439;class=Strain TY2439] | ||
+ | | III | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=yIs4;class=Transgene yIs4] | + | | [http://www.wormbase.org/db/get?name=yIs4;class=Transgene yIs4] |
+ | | [HA::SDC-3], provide excess sdc-3. | ||
+ | | | ||
+ | | | ||
+ | | X | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=yIs58;class=Transgene yIs58] | + | | [http://www.wormbase.org/db/get?name=yIs58;class=Transgene yIs58] |
+ | | [myo-2::gfp; ceh-39(+)] | ||
+ | | GFP | ||
+ | | | ||
+ | | IV | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=ybIs736;class=Transgene ybIs736] | + | | [http://www.wormbase.org/db/get?name=ybIs736;class=Transgene ybIs736] |
+ | | [myo-3::EGL-15BGAR] | ||
+ | | BGAR | ||
+ | | | ||
+ | | X | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=ynIs12;class=Transgene ynIs12] | + | | [http://www.wormbase.org/db/get?name=ynIs12;class=Transgene ynIs12] |
+ | | [snb-1::apl-1] | ||
+ | | | ||
+ | | | ||
+ | | III | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=ynIs13;class=Transgene ynIs13] | + | | [http://www.wormbase.org/db/get?name=ynIs13;class=Transgene ynIs13] |
+ | | [snb-1::apl-1] | ||
+ | | | ||
+ | | | ||
+ | | V | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=ynIs21;class=Transgene ynIs21] | + | | [http://www.wormbase.org/db/get?name=ynIs21;class=Transgene ynIs21] |
+ | | [flp-3::gfp] | ||
+ | | GFP | ||
+ | | | ||
+ | | V | ||
+ | | [http://www.wormbase.org/db/get?name=Expr3005;class=Expr_pattern Expr3005] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00001446;class=Gene flp-3] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0005119;class=Anatomy_term IL1 neuron]<br>[http://www.wormbase.org/db/get?name=WBbt:0004096;class=Anatomy_term PQR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004887;class=Anatomy_term CP9]<br>[http://www.wormbase.org/db/get?name=WBbt:0005323;class=Anatomy_term] | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00024197;class=Paper WBPaper00024197] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=ynIs22;class=Transgene ynIs22] | + | | [http://www.wormbase.org/db/get?name=ynIs22;class=Transgene ynIs22] |
+ | | [flp-8::gfp] | ||
+ | | GFP | ||
+ | | | ||
+ | | III | ||
+ | | [http://www.wormbase.org/db/get?name=Expr3010;class=Expr_pattern Expr3010] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00001451;class=Gene flp-8] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0003871;class=Anatomy_term AUAR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004013;class=Anatomy_term ADAL]<br>[http://www.wormbase.org/db/get?name=WBbt:0005017;class=Anatomy_term RMGL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004086;class=Anatomy_term PVM]<br>[http://www.wormbase.org/db/get?name=WBbt:0004011;class=Anatomy_term ADAR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004887;class=Anatomy_term CP9]<br>[http://www.wormbase.org/db/get?name=WBbt:0003872;class=Anatomy_term AUAL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004926;class=Anatomy_term URXR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004928;class=Anatomy_term URXL]<br>[http://www.wormbase.org/db/get?name=WBbt:0005013;class=Anatomy_term RMGR] | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00024197;class=Paper WBPaper00024197] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=ynIs24;class=Transgene ynIs24] | + | | [http://www.wormbase.org/db/get?name=ynIs24;class=Transgene ynIs24] |
+ | | [flp-5::gfp] | ||
+ | | GFP | ||
+ | | | ||
+ | | V | ||
+ | | [http://www.wormbase.org/db/get?name=Expr3030;class=Expr_pattern Expr3030] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00001448;class=Gene flp-5] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0004000;class=Anatomy_term R7BR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004021;class=Anatomy_term R5BR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004046;class=Anatomy_term R1BR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004001;class=Anatomy_term R7BL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004022;class=Anatomy_term R5BL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004048;class=Anatomy_term R1BL] | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00006506;class=Paper WBPaper00006506] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=ynIs25;class=Transgene ynIs25] | + | | [http://www.wormbase.org/db/get?name=ynIs25;class=Transgene ynIs25] |
+ | | [flp-12::gfp] | ||
+ | | GFP | ||
+ | | | ||
+ | | II | ||
+ | | [http://www.wormbase.org/db/get?name=Expr3013;class=Expr_pattern Expr3013] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00001455;class=Gene flp-12] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0004029;class=Anatomy_term R4AR]<br>[http://www.wormbase.org/db/get?name=WBbt:0005001;class=Anatomy_term SAAVR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004000;class=Anatomy_term R7BR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004024;class=Anatomy_term R5AL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004027;class=Anatomy_term R4BR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004072;class=Anatomy_term PVR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004030;class=Anatomy_term R4AL]<br>[http://www.wormbase.org/db/get?name=WBbt:0005003;class=Anatomy_term SAAVL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004386;class=Anatomy_term PDA]<br>[http://www.wormbase.org/db/get?name=WBbt:0003847;class=Anatomy_term AVJL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004002;class=Anatomy_term R7AR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004052;class=Anatomy_term R1AL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004975;class=Anatomy_term SMBDR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004021;class=Anatomy_term R5BR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003812;class=Anatomy_term BDUL]<br>[http://www.wormbase.org/db/get?name=WBbt:0003824;class=Anatomy_term BAGL]<br>[http://www.wormbase.org/db/get?name=WBbt:0005007;class=Anatomy_term SAADL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004887;class=Anatomy_term CP9]<br>[http://www.wormbase.org/db/get?name=WBbt:0004028;class=Anatomy_term R4BL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004046;class=Anatomy_term R1BR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003849;class=Anatomy_term AVHL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004993;class=Anatomy_term SDQL]<br>[http://www.wormbase.org/db/get?name=WBbt:0005005;class=Anatomy_term SAADR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004050;class=Anatomy_term R1AR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004973;class=Anatomy_term SMBVR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004991;class=Anatomy_term SDQR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004006;class=Anatomy_term R7AL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004974;class=Anatomy_term SMBVL]<br>[http://www.wormbase.org/db/get?name=WBbt:0003848;class=Anatomy_term AVHR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004001;class=Anatomy_term R7BL]<br>[http://www.wormbase.org/db/get?name=WBbt:0003846;class=Anatomy_term AVJR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003811;class=Anatomy_term BDUR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004976;class=Anatomy_term SMBDL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004023;class=Anatomy_term R5AR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003823;class=Anatomy_term BAGR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004022;class=Anatomy_term R5BL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004048;class=Anatomy_term R1BL] | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00024197;class=Paper WBPaper00024197] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=ynIs26;class=Transgene ynIs26] | + | | [http://www.wormbase.org/db/get?name=ynIs26;class=Transgene ynIs26] |
+ | | [flp-12::gfp] | ||
+ | | GFP | ||
+ | | | ||
+ | | I | ||
+ | | [http://www.wormbase.org/db/get?name=Expr3013;class=Expr_pattern Expr3013] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00001455;class=Gene flp-12] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0004029;class=Anatomy_term R4AR]<br>[http://www.wormbase.org/db/get?name=WBbt:0005001;class=Anatomy_term SAAVR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004000;class=Anatomy_term R7BR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004024;class=Anatomy_term R5AL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004027;class=Anatomy_term R4BR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004072;class=Anatomy_term PVR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004030;class=Anatomy_term R4AL]<br>[http://www.wormbase.org/db/get?name=WBbt:0005003;class=Anatomy_term SAAVL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004386;class=Anatomy_term PDA]<br>[http://www.wormbase.org/db/get?name=WBbt:0003847;class=Anatomy_term AVJL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004002;class=Anatomy_term R7AR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004052;class=Anatomy_term R1AL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004975;class=Anatomy_term SMBDR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004021;class=Anatomy_term R5BR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003812;class=Anatomy_term BDUL]<br>[http://www.wormbase.org/db/get?name=WBbt:0003824;class=Anatomy_term BAGL]<br>[http://www.wormbase.org/db/get?name=WBbt:0005007;class=Anatomy_term SAADL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004887;class=Anatomy_term CP9]<br>[http://www.wormbase.org/db/get?name=WBbt:0004028;class=Anatomy_term R4BL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004046;class=Anatomy_term R1BR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003849;class=Anatomy_term AVHL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004993;class=Anatomy_term SDQL]<br>[http://www.wormbase.org/db/get?name=WBbt:0005005;class=Anatomy_term SAADR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004050;class=Anatomy_term R1AR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004973;class=Anatomy_term SMBVR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004991;class=Anatomy_term SDQR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004006;class=Anatomy_term R7AL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004974;class=Anatomy_term SMBVL]<br>[http://www.wormbase.org/db/get?name=WBbt:0003848;class=Anatomy_term AVHR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004001;class=Anatomy_term R7BL]<br>[http://www.wormbase.org/db/get?name=WBbt:0003846;class=Anatomy_term AVJR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003811;class=Anatomy_term BDUR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004976;class=Anatomy_term SMBDL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004023;class=Anatomy_term R5AR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003823;class=Anatomy_term BAGR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004022;class=Anatomy_term R5BL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004048;class=Anatomy_term R1BL] | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00024197;class=Paper WBPaper00024197] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=ynIs30;class=Transgene ynIs30] | + | | [http://www.wormbase.org/db/get?name=ynIs30;class=Transgene ynIs30] |
+ | | [flp-4::gfp] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=NY2030;class=Strain NY2030] | ||
+ | | I | ||
+ | | [http://www.wormbase.org/db/get?name=Expr3006;class=Expr_pattern Expr3006] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00001447;class=Gene flp-4] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0003995;class=Anatomy_term ADLR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004365;class=Anatomy_term PHAR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003997;class=Anatomy_term ADLL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004088;class=Anatomy_term PVDR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004740;class=Anatomy_term I5]<br>[http://www.wormbase.org/db/get?name=WBbt:0003826;class=Anatomy_term AWCR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004797;class=Anatomy_term FLPR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004090;class=Anatomy_term PVDL]<br>[http://www.wormbase.org/db/get?name=WBbt:0003904;class=Anatomy_term ASEL]<br>[http://www.wormbase.org/db/get?name=WBbt:0003827;class=Anatomy_term AWCL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004366;class=Anatomy_term PHAL]<br>[http://www.wormbase.org/db/get?name=WBbt:0005659;class=Anatomy_term PHBR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004364;class=Anatomy_term PHBL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004446;class=Anatomy_term NSMR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003832;class=Anatomy_term AVM]<br>[http://www.wormbase.org/db/get?name=WBbt:0004739;class=Anatomy_term I6]<br>[http://www.wormbase.org/db/get?name=WBbt:0004798;class=Anatomy_term FLPL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004457;class=Anatomy_term NSML] | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00024197;class=Paper WBPaper00024197] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=ynIs34;class=Transgene ynIs34] | + | | [http://www.wormbase.org/db/get?name=ynIs34;class=Transgene ynIs34] |
+ | | [flp-19::gfp] | ||
+ | | GFP | ||
+ | | | ||
+ | | IV | ||
+ | | [http://www.wormbase.org/db/get?name=Expr3018;class=Expr_pattern Expr3018] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00001462;class=Gene flp-19] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0003967;class=Anatomy_term AINL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004757;class=Anatomy_term HSNR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003970;class=Anatomy_term R9AR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004000;class=Anatomy_term R7BR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004024;class=Anatomy_term R5AL]<br>[http://www.wormbase.org/db/get?name=WBbt:0003831;class=Anatomy_term AWAL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004939;class=Anatomy_term CEMVR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004002;class=Anatomy_term R7AR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004941;class=Anatomy_term CEMVL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004021;class=Anatomy_term R5BR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003824;class=Anatomy_term BAGL]<br>[http://www.wormbase.org/db/get?name=WBbt:0005741;class=Anatomy_term tail]<br>[http://www.wormbase.org/db/get?name=WBbt:0004945;class=Anatomy_term CEMDL]<br>[http://www.wormbase.org/db/get?name=WBbt:0003968;class=Anatomy_term R9BL]<br>[http://www.wormbase.org/db/get?name=WBbt:0003965;class=Anatomy_term AINR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004926;class=Anatomy_term URXR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004006;class=Anatomy_term R7AL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004928;class=Anatomy_term URXL]<br>[http://www.wormbase.org/db/get?name=WBbt:0003966;class=Anatomy_term R9BR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004943;class=Anatomy_term CEMDR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003830;class=Anatomy_term AWAR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004001;class=Anatomy_term R7BL]<br>[http://www.wormbase.org/db/get?name=WBbt:0003971;class=Anatomy_term R9AL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004023;class=Anatomy_term R5AR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003823;class=Anatomy_term BAGR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004758;class=Anatomy_term HSNL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004022;class=Anatomy_term R5BL] | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00024197;class=Paper WBPaper00024197] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=ynIs37;class=Transgene ynIs37] | + | | [http://www.wormbase.org/db/get?name=ynIs37;class=Transgene ynIs37] |
+ | | [flp-13::gfp] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=NY2037;class=Strain NY2037] | ||
+ | | III | ||
+ | | [http://www.wormbase.org/db/get?name=Expr3014;class=Expr_pattern Expr3014] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00001456;class=Gene flp-13] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0004469;class=Anatomy_term m3R]<br>[http://www.wormbase.org/db/get?name=WBbt:0003892;class=Anatomy_term ASGL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004740;class=Anatomy_term I5]<br>[http://www.wormbase.org/db/get?name=WBbt:0003884;class=Anatomy_term ASKL]<br>[http://www.wormbase.org/db/get?name=WBbt:0005270;class=Anatomy_term DD neuron]<br>[http://www.wormbase.org/db/get?name=WBbt:0004471;class=Anatomy_term m3L]<br>[http://www.wormbase.org/db/get?name=WBbt:0004465;class=Anatomy_term M5]<br>[http://www.wormbase.org/db/get?name=WBbt:0003824;class=Anatomy_term BAGL]<br>[http://www.wormbase.org/db/get?name=WBbt:0003904;class=Anatomy_term ASEL]<br>[http://www.wormbase.org/db/get?name=WBbt:0005826;class=Anatomy_term spicule protractor muscle]<br>[http://www.wormbase.org/db/get?name=WBbt:0003891;class=Anatomy_term ASGR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003883;class=Anatomy_term ASKR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003903;class=Anatomy_term ASER]<br>[http://www.wormbase.org/db/get?name=WBbt:0003823;class=Anatomy_term BAGR] | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00024197;class=Paper WBPaper00024197] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=ynIs37;class=Transgene ynIs37] | + | | [http://www.wormbase.org/db/get?name=ynIs37;class=Transgene ynIs37] |
+ | | [flp-13::gfp] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=NY2037;class=Strain NY2037] | ||
+ | | III | ||
+ | | [http://www.wormbase.org/db/get?name=Expr7935;class=Expr_pattern Expr7935] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00001456;class=Gene flp-13] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0003904;class=Anatomy_term ASEL]<br>[http://www.wormbase.org/db/get?name=WBbt:0003903;class=Anatomy_term ASER]<br>[http://www.wormbase.org/db/get?name=WBbt:0003679;class=Anatomy_term neuron] | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00030829;class=Paper WBPaper00030829] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=ynIs38;class=Transgene ynIs38] | + | | [http://www.wormbase.org/db/get?name=ynIs38;class=Transgene ynIs38] |
+ | | [flp-13::gfp] | ||
+ | | GFP | ||
+ | | | ||
+ | | V | ||
+ | | [http://www.wormbase.org/db/get?name=Expr3014;class=Expr_pattern Expr3014] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00001456;class=Gene flp-13] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0004469;class=Anatomy_term m3R]<br>[http://www.wormbase.org/db/get?name=WBbt:0003892;class=Anatomy_term ASGL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004740;class=Anatomy_term I5]<br>[http://www.wormbase.org/db/get?name=WBbt:0003884;class=Anatomy_term ASKL]<br>[http://www.wormbase.org/db/get?name=WBbt:0005270;class=Anatomy_term DD neuron]<br>[http://www.wormbase.org/db/get?name=WBbt:0004471;class=Anatomy_term m3L]<br>[http://www.wormbase.org/db/get?name=WBbt:0004465;class=Anatomy_term M5]<br>[http://www.wormbase.org/db/get?name=WBbt:0003824;class=Anatomy_term BAGL]<br>[http://www.wormbase.org/db/get?name=WBbt:0003904;class=Anatomy_term ASEL]<br>[http://www.wormbase.org/db/get?name=WBbt:0005826;class=Anatomy_term spicule protractor muscle]<br>[http://www.wormbase.org/db/get?name=WBbt:0003891;class=Anatomy_term ASGR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003883;class=Anatomy_term ASKR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003903;class=Anatomy_term ASER]<br>[http://www.wormbase.org/db/get?name=WBbt:0003823;class=Anatomy_term BAGR] | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00024197;class=Paper WBPaper00024197] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=ynIs40;class=Transgene ynIs40] | + | | [http://www.wormbase.org/db/get?name=ynIs40;class=Transgene ynIs40] |
+ | | [flp-11::gfp] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=NY2040;class=Strain NY2040] | ||
+ | | V | ||
+ | | [http://www.wormbase.org/db/get?name=Expr3012;class=Expr_pattern Expr3012] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00001454;class=Gene flp-11] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0004029;class=Anatomy_term R4AR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003871;class=Anatomy_term AUAR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004094;class=Anatomy_term PVCL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004027;class=Anatomy_term R4BR]<br>[http://www.wormbase.org/db/get?name=WBbt:0005303;class=Anatomy_term VD neuron]<br>[http://www.wormbase.org/db/get?name=WBbt:0004030;class=Anatomy_term R4AL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004997;class=Anatomy_term SABVR]<br>[http://www.wormbase.org/db/get?name=WBbt:0006791;class=Anatomy_term uv1]<br>[http://www.wormbase.org/db/get?name=WBbt:0005270;class=Anatomy_term DD neuron]<br>[http://www.wormbase.org/db/get?name=WBbt:0005278;class=Anatomy_term DA neuron]<br>[http://www.wormbase.org/db/get?name=WBbt:0003824;class=Anatomy_term BAGL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004092;class=Anatomy_term PVCR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004028;class=Anatomy_term R4BL]<br>[http://www.wormbase.org/db/get?name=WBbt:0006761;class=Anatomy_term head muscle]<br>[http://www.wormbase.org/db/get?name=WBbt:0004998;class=Anatomy_term SABVL]<br>[http://www.wormbase.org/db/get?name=WBbt:0003872;class=Anatomy_term AUAL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004362;class=Anatomy_term PHCL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004822;class=Anatomy_term DVB]<br>[http://www.wormbase.org/db/get?name=WBbt:0004926;class=Anatomy_term URXR]<br>[http://www.wormbase.org/db/get?name=WBbt:0005750;class=Anatomy_term socket cell]<br>[http://www.wormbase.org/db/get?name=WBbt:0004118;class=Anatomy_term PHCR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004928;class=Anatomy_term URXL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004491;class=Anatomy_term LUAR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004999;class=Anatomy_term SABD]<br>[http://www.wormbase.org/db/get?name=WBbt:0004493;class=Anatomy_term LUAL]<br>[http://www.wormbase.org/db/get?name=WBbt:0003823;class=Anatomy_term BAGR] | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00024197;class=Paper WBPaper00024197] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=ynIs41;class=Transgene ynIs41] | + | | [http://www.wormbase.org/db/get?name=ynIs41;class=Transgene ynIs41] |
+ | | [flp-11::gfp] | ||
+ | | GFP | ||
+ | | | ||
+ | | I | ||
+ | | [http://www.wormbase.org/db/get?name=Expr3012;class=Expr_pattern Expr3012] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00001454;class=Gene flp-11] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0004029;class=Anatomy_term R4AR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003871;class=Anatomy_term AUAR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004094;class=Anatomy_term PVCL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004027;class=Anatomy_term R4BR]<br>[http://www.wormbase.org/db/get?name=WBbt:0005303;class=Anatomy_term VD neuron]<br>[http://www.wormbase.org/db/get?name=WBbt:0004030;class=Anatomy_term R4AL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004997;class=Anatomy_term SABVR]<br>[http://www.wormbase.org/db/get?name=WBbt:0006791;class=Anatomy_term uv1]<br>[http://www.wormbase.org/db/get?name=WBbt:0005270;class=Anatomy_term DD neuron]<br>[http://www.wormbase.org/db/get?name=WBbt:0005278;class=Anatomy_term DA neuron]<br>[http://www.wormbase.org/db/get?name=WBbt:0003824;class=Anatomy_term BAGL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004092;class=Anatomy_term PVCR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004028;class=Anatomy_term R4BL]<br>[http://www.wormbase.org/db/get?name=WBbt:0006761;class=Anatomy_term head muscle]<br>[http://www.wormbase.org/db/get?name=WBbt:0004998;class=Anatomy_term SABVL]<br>[http://www.wormbase.org/db/get?name=WBbt:0003872;class=Anatomy_term AUAL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004362;class=Anatomy_term PHCL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004822;class=Anatomy_term DVB]<br>[http://www.wormbase.org/db/get?name=WBbt:0004926;class=Anatomy_term URXR]<br>[http://www.wormbase.org/db/get?name=WBbt:0005750;class=Anatomy_term socket cell]<br>[http://www.wormbase.org/db/get?name=WBbt:0004118;class=Anatomy_term PHCR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004928;class=Anatomy_term URXL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004491;class=Anatomy_term LUAR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004999;class=Anatomy_term SABD]<br>[http://www.wormbase.org/db/get?name=WBbt:0004493;class=Anatomy_term LUAL]<br>[http://www.wormbase.org/db/get?name=WBbt:0003823;class=Anatomy_term BAGR] | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00024197;class=Paper WBPaper00024197] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=ynIs45;class=Transgene ynIs45] | + | | [http://www.wormbase.org/db/get?name=ynIs45;class=Transgene ynIs45] |
+ | | [flp-15::gfp] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=NY2045;class=Strain NY2045] | ||
+ | | I | ||
+ | | [http://www.wormbase.org/db/get?name=Expr3015;class=Expr_pattern Expr3015] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00001458;class=Gene flp-15] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0005451;class=Anatomy_term pharyngeal muscle cell]<br>[http://www.wormbase.org/db/get?name=WBbt:0004365;class=Anatomy_term PHAR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004366;class=Anatomy_term PHAL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004744;class=Anatomy_term I2L]<br>[http://www.wormbase.org/db/get?name=WBbt:0004743;class=Anatomy_term I2R]<br>[http://www.wormbase.org/db/get?name=WBbt:0005750;class=Anatomy_term socket cell]<br>[http://www.wormbase.org/db/get?name=WBbt:0005811;class=Anatomy_term neuronal sheath cell] | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00024197;class=Paper WBPaper00024197] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=ynIs49;class=Transgene ynIs49] | + | | [http://www.wormbase.org/db/get?name=ynIs49;class=Transgene ynIs49] |
+ | | [flp-5::gfp] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=NY2049;class=Strain NY2049] | ||
+ | | V | ||
+ | | [http://www.wormbase.org/db/get?name=Expr3007;class=Expr_pattern Expr3007] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00001448;class=Gene flp-5] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0005451;class=Anatomy_term pharyngeal muscle cell]<br>[http://www.wormbase.org/db/get?name=WBbt:0004000;class=Anatomy_term R7BR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004024;class=Anatomy_term R5AL]<br>[http://www.wormbase.org/db/get?name=WBbt:0006777;class=Anatomy_term P8]<br>[http://www.wormbase.org/db/get?name=WBbt:0004070;class=Anatomy_term PVT]<br>[http://www.wormbase.org/db/get?name=WBbt:0005017;class=Anatomy_term RMGL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004002;class=Anatomy_term R7AR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004052;class=Anatomy_term R1AL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004761;class=Anatomy_term HOB]<br>[http://www.wormbase.org/db/get?name=WBbt:0004021;class=Anatomy_term R5BR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003904;class=Anatomy_term ASEL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004744;class=Anatomy_term I2L]<br>[http://www.wormbase.org/db/get?name=WBbt:0004046;class=Anatomy_term R1BR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004743;class=Anatomy_term I2R]<br>[http://www.wormbase.org/db/get?name=WBbt:0004050;class=Anatomy_term R1AR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004741;class=Anatomy_term I4]<br>[http://www.wormbase.org/db/get?name=WBbt:0004006;class=Anatomy_term R7AL]<br>[http://www.wormbase.org/db/get?name=WBbt:0005013;class=Anatomy_term RMGR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004001;class=Anatomy_term R7BL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004467;class=Anatomy_term M4]<br>[http://www.wormbase.org/db/get?name=WBbt:0004023;class=Anatomy_term R5AR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003903;class=Anatomy_term ASER]<br>[http://www.wormbase.org/db/get?name=WBbt:0004022;class=Anatomy_term R5BL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004048;class=Anatomy_term R1BL] | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00024197;class=Paper WBPaper00024197] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=ynIs50;class=Transgene ynIs50] | + | | [http://www.wormbase.org/db/get?name=ynIs50;class=Transgene ynIs50] |
+ | | [flp-22::gfp] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=NY2050;class=Strain NY2050] | ||
+ | | IV | ||
+ | | [http://www.wormbase.org/db/get?name=Expr3021;class=Expr_pattern Expr3021] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00009562;class=Gene flp-22] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0003870;class=Anatomy_term AVAL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004066;class=Anatomy_term PVWL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004972;class=Anatomy_term SMDDL]<br>[http://www.wormbase.org/db/get?name=WBbt:0003940;class=Anatomy_term RICR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003869;class=Anatomy_term AVAR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004064;class=Anatomy_term PVWR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004931;class=Anatomy_term CEPVR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004088;class=Anatomy_term PVDR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003892;class=Anatomy_term ASGL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004936;class=Anatomy_term URADR]<br>[http://www.wormbase.org/db/get?name=WBbt:0006791;class=Anatomy_term uv1]<br>[http://www.wormbase.org/db/get?name=WBbt:0004090;class=Anatomy_term PVDL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004935;class=Anatomy_term URAVL]<br>[http://www.wormbase.org/db/get?name=WBbt:0003969;class=Anatomy_term AIMR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003843;class=Anatomy_term AVL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004970;class=Anatomy_term SMDVL]<br>[http://www.wormbase.org/db/get?name=WBbt:0003957;class=Anatomy_term AIZR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003941;class=Anatomy_term RICL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004937;class=Anatomy_term CEPDR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004971;class=Anatomy_term SMDDR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003891;class=Anatomy_term ASGR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004933;class=Anatomy_term CEPVL]<br>[http://www.wormbase.org/db/get?name=WBbt:0003850;class=Anatomy_term AVG]<br>[http://www.wormbase.org/db/get?name=WBbt:0003959;class=Anatomy_term AIZL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004934;class=Anatomy_term URAVR]<br>[http://www.wormbase.org/db/get?name=WBbt:0005041;class=Anatomy_term RIVR]<br>[http://www.wormbase.org/db/get?name=WBbt:0005310;class=Anatomy_term CP neuron]<br>[http://www.wormbase.org/db/get?name=WBbt:0004938;class=Anatomy_term CEPDL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004969;class=Anatomy_term SMDVR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003983;class=Anatomy_term AIML]<br>[http://www.wormbase.org/db/get?name=WBbt:0004940;class=Anatomy_term URADL]<br>[http://www.wormbase.org/db/get?name=WBbt:0005043;class=Anatomy_term RIVL] | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00024197;class=Paper WBPaper00024197] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=ynIs51;class=Transgene ynIs51] | + | | [http://www.wormbase.org/db/get?name=ynIs51;class=Transgene ynIs51] |
+ | | [flp-22::gfp] | ||
+ | | GFP | ||
+ | | | ||
+ | | III | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=ynIs52;class=Transgene ynIs52] | + | | [http://www.wormbase.org/db/get?name=ynIs52;class=Transgene ynIs52] |
+ | | [flp-5::gfp] | ||
+ | | GFP | ||
+ | | | ||
+ | | V | ||
+ | | [http://www.wormbase.org/db/get?name=Expr3007;class=Expr_pattern Expr3007] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00001448;class=Gene flp-5] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0005451;class=Anatomy_term pharyngeal muscle cell]<br>[http://www.wormbase.org/db/get?name=WBbt:0004000;class=Anatomy_term R7BR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004024;class=Anatomy_term R5AL]<br>[http://www.wormbase.org/db/get?name=WBbt:0006777;class=Anatomy_term P8]<br>[http://www.wormbase.org/db/get?name=WBbt:0004070;class=Anatomy_term PVT]<br>[http://www.wormbase.org/db/get?name=WBbt:0005017;class=Anatomy_term RMGL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004002;class=Anatomy_term R7AR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004052;class=Anatomy_term R1AL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004761;class=Anatomy_term HOB]<br>[http://www.wormbase.org/db/get?name=WBbt:0004021;class=Anatomy_term R5BR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003904;class=Anatomy_term ASEL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004744;class=Anatomy_term I2L]<br>[http://www.wormbase.org/db/get?name=WBbt:0004046;class=Anatomy_term R1BR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004743;class=Anatomy_term I2R]<br>[http://www.wormbase.org/db/get?name=WBbt:0004050;class=Anatomy_term R1AR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004741;class=Anatomy_term I4]<br>[http://www.wormbase.org/db/get?name=WBbt:0004006;class=Anatomy_term R7AL]<br>[http://www.wormbase.org/db/get?name=WBbt:0005013;class=Anatomy_term RMGR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004001;class=Anatomy_term R7BL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004467;class=Anatomy_term M4]<br>[http://www.wormbase.org/db/get?name=WBbt:0004023;class=Anatomy_term R5AR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003903;class=Anatomy_term ASER]<br>[http://www.wormbase.org/db/get?name=WBbt:0004022;class=Anatomy_term R5BL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004048;class=Anatomy_term R1BL] | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00024197;class=Paper WBPaper00024197] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=ynIs53;class=Transgene ynIs53] | + | | [http://www.wormbase.org/db/get?name=ynIs53;class=Transgene ynIs53] |
+ | | [flp-20::gfp] | ||
+ | | GFP | ||
+ | | | ||
+ | | IV | ||
+ | | [http://www.wormbase.org/db/get?name=Expr3019;class=Expr_pattern Expr3019] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00001463;class=Gene flp-20] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0003985;class=Anatomy_term AIBL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004094;class=Anatomy_term PVCL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004072;class=Anatomy_term PVR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003942;class=Anatomy_term RIBR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004070;class=Anatomy_term PVT]<br>[http://www.wormbase.org/db/get?name=WBbt:0004086;class=Anatomy_term PVM]<br>[http://www.wormbase.org/db/get?name=WBbt:0004103;class=Anatomy_term PLMR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003953;class=Anatomy_term ALMR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003904;class=Anatomy_term ASEL]<br>[http://www.wormbase.org/db/get?name=WBbt:0003984;class=Anatomy_term AIBR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004092;class=Anatomy_term PVCR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003956;class=Anatomy_term RIBL]<br>[http://www.wormbase.org/db/get?name=WBbt:0003954;class=Anatomy_term ALML]<br>[http://www.wormbase.org/db/get?name=WBbt:0003832;class=Anatomy_term AVM]<br>[http://www.wormbase.org/db/get?name=WBbt:0004491;class=Anatomy_term LUAR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004104;class=Anatomy_term PLML]<br>[http://www.wormbase.org/db/get?name=WBbt:0004493;class=Anatomy_term LUAL]<br>[http://www.wormbase.org/db/get?name=WBbt:0003903;class=Anatomy_term ASER] | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00024197;class=Paper WBPaper00024197] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=ynIs54;class=Transgene ynIs54] | + | | [http://www.wormbase.org/db/get?name=ynIs54;class=Transgene ynIs54] |
+ | | [flp-20::gfp] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=NY2054;class=Strain NY2054] | ||
+ | | V | ||
+ | | [http://www.wormbase.org/db/get?name=Expr3019;class=Expr_pattern Expr3019] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00001463;class=Gene flp-20] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0003985;class=Anatomy_term AIBL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004094;class=Anatomy_term PVCL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004072;class=Anatomy_term PVR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003942;class=Anatomy_term RIBR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004070;class=Anatomy_term PVT]<br>[http://www.wormbase.org/db/get?name=WBbt:0004086;class=Anatomy_term PVM]<br>[http://www.wormbase.org/db/get?name=WBbt:0004103;class=Anatomy_term PLMR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003953;class=Anatomy_term ALMR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003904;class=Anatomy_term ASEL]<br>[http://www.wormbase.org/db/get?name=WBbt:0003984;class=Anatomy_term AIBR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004092;class=Anatomy_term PVCR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003956;class=Anatomy_term RIBL]<br>[http://www.wormbase.org/db/get?name=WBbt:0003954;class=Anatomy_term ALML]<br>[http://www.wormbase.org/db/get?name=WBbt:0003832;class=Anatomy_term AVM]<br>[http://www.wormbase.org/db/get?name=WBbt:0004491;class=Anatomy_term LUAR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004104;class=Anatomy_term PLML]<br>[http://www.wormbase.org/db/get?name=WBbt:0004493;class=Anatomy_term LUAL]<br>[http://www.wormbase.org/db/get?name=WBbt:0003903;class=Anatomy_term ASER] | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00024197;class=Paper WBPaper00024197] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=ynIs57;class=Transgene ynIs57] | + | | [http://www.wormbase.org/db/get?name=ynIs57;class=Transgene ynIs57] |
+ | | [flp-2::gfp] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=NY2057;class=Strain NY2057] | ||
+ | | III | ||
+ | | [http://www.wormbase.org/db/get?name=Expr3004;class=Expr_pattern Expr3004] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00001445;class=Gene flp-2] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0004066;class=Anatomy_term PVWL]<br>[http://www.wormbase.org/db/get?name=WBbt:0003887;class=Anatomy_term ASIR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004064;class=Anatomy_term PVWR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004740;class=Anatomy_term I5]<br>[http://www.wormbase.org/db/get?name=WBbt:0004463;class=Anatomy_term MCL]<br>[http://www.wormbase.org/db/get?name=WBbt:0006761;class=Anatomy_term head muscle]<br>[http://www.wormbase.org/db/get?name=WBbt:0003987;class=Anatomy_term AIAR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003989;class=Anatomy_term AIAL]<br>[http://www.wormbase.org/db/get?name=WBbt:0003938;class=Anatomy_term RID]<br>[http://www.wormbase.org/db/get?name=WBbt:0003888;class=Anatomy_term ASIL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004467;class=Anatomy_term M4]<br>[http://www.wormbase.org/db/get?name=WBbt:0004461;class=Anatomy_term MCR] | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00024197;class=Paper WBPaper00024197] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=ynIs58;class=Transgene ynIs58] | + | | [http://www.wormbase.org/db/get?name=ynIs58;class=Transgene ynIs58] |
+ | | [flp-15::gfp] | ||
+ | | GFP | ||
+ | | | ||
+ | | X | ||
+ | | [http://www.wormbase.org/db/get?name=Expr3015;class=Expr_pattern Expr3015] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00001458;class=Gene flp-15] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0005451;class=Anatomy_term pharyngeal muscle cell]<br>[http://www.wormbase.org/db/get?name=WBbt:0004365;class=Anatomy_term PHAR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004366;class=Anatomy_term PHAL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004744;class=Anatomy_term I2L]<br>[http://www.wormbase.org/db/get?name=WBbt:0004743;class=Anatomy_term I2R]<br>[http://www.wormbase.org/db/get?name=WBbt:0005750;class=Anatomy_term socket cell]<br>[http://www.wormbase.org/db/get?name=WBbt:0005811;class=Anatomy_term neuronal sheath cell] | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00024197;class=Paper WBPaper00024197] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=ynIs64;class=Transgene ynIs64] | + | | [http://www.wormbase.org/db/get?name=ynIs64;class=Transgene ynIs64] |
+ | | [flp-17::gfp] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=NY2064;class=Strain NY2064] | ||
+ | | I | ||
+ | | [http://www.wormbase.org/db/get?name=Expr3016;class=Expr_pattern Expr3016] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00001460;class=Gene flp-17] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0004000;class=Anatomy_term R7BR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004024;class=Anatomy_term R5AL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004002;class=Anatomy_term R7AR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004052;class=Anatomy_term R1AL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004465;class=Anatomy_term M5]<br>[http://www.wormbase.org/db/get?name=WBbt:0004021;class=Anatomy_term R5BR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003824;class=Anatomy_term BAGL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004046;class=Anatomy_term R1BR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004050;class=Anatomy_term R1AR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004006;class=Anatomy_term R7AL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004001;class=Anatomy_term R7BL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004023;class=Anatomy_term R5AR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003823;class=Anatomy_term BAGR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004022;class=Anatomy_term R5BL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004048;class=Anatomy_term R1BL] | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00024197;class=Paper WBPaper00024197] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=ynIs64;class=Transgene ynIs64] | + | | [http://www.wormbase.org/db/get?name=ynIs64;class=Transgene ynIs64] |
+ | | [flp-17::gfp] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=NY2064;class=Strain NY2064] | ||
+ | | I | ||
+ | | [http://www.wormbase.org/db/get?name=Expr3033;class=Expr_pattern Expr3033] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00001460;class=Gene flp-17] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0004000;class=Anatomy_term R7BR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004021;class=Anatomy_term R5BR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004046;class=Anatomy_term R1BR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004001;class=Anatomy_term R7BL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004022;class=Anatomy_term R5BL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004048;class=Anatomy_term R1BL] | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00006506;class=Paper WBPaper00006506] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=ynIs66;class=Transgene ynIs66] | + | | [http://www.wormbase.org/db/get?name=ynIs66;class=Transgene ynIs66] |
+ | | [flp-7::gfp] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=NY2066;class=Strain NY2066] | ||
+ | | IV | ||
+ | | [http://www.wormbase.org/db/get?name=Expr3009;class=Expr_pattern Expr3009] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00001450;class=Gene flp-7] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0005001;class=Anatomy_term SAAVR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004066;class=Anatomy_term PVWL]<br>[http://www.wormbase.org/db/get?name=WBbt:0003940;class=Anatomy_term RICR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004365;class=Anatomy_term PHAR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004064;class=Anatomy_term PVWR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003955;class=Anatomy_term ALA]<br>[http://www.wormbase.org/db/get?name=WBbt:0005003;class=Anatomy_term SAAVL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004386;class=Anatomy_term PDA]<br>[http://www.wormbase.org/db/get?name=WBbt:0004970;class=Anatomy_term SMDVL]<br>[http://www.wormbase.org/db/get?name=WBbt:0005007;class=Anatomy_term SAADL]<br>[http://www.wormbase.org/db/get?name=WBbt:0003941;class=Anatomy_term RICL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004366;class=Anatomy_term PHAL]<br>[http://www.wormbase.org/db/get?name=WBbt:0005659;class=Anatomy_term PHBR]<br>[http://www.wormbase.org/db/get?name=WBbt:0005005;class=Anatomy_term SAADR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004364;class=Anatomy_term PHBL]<br>[http://www.wormbase.org/db/get?name=WBbt:0003850;class=Anatomy_term AVG]<br>[http://www.wormbase.org/db/get?name=WBbt:0005029;class=Anatomy_term RMDVR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004969;class=Anatomy_term SMDVR]<br>[http://www.wormbase.org/db/get?name=WBbt:0005031;class=Anatomy_term RMDVL] | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00024197;class=Paper WBPaper00024197] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=ynIs67;class=Transgene ynIs67] | + | | [http://www.wormbase.org/db/get?name=ynIs67;class=Transgene ynIs67] |
+ | | [flp-6::gfp] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=NY2067;class=Strain NY2067] | ||
+ | | III | ||
+ | | [http://www.wormbase.org/db/get?name=Expr3008;class=Expr_pattern Expr3008] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00001449;class=Gene flp-6] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0004000;class=Anatomy_term R7BR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004024;class=Anatomy_term R5AL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004040;class=Anatomy_term R2BL]<br>[http://www.wormbase.org/db/get?name=WBbt:0003892;class=Anatomy_term ASGL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004070;class=Anatomy_term PVT]<br>[http://www.wormbase.org/db/get?name=WBbt:0004002;class=Anatomy_term R7AR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004042;class=Anatomy_term R2AL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004021;class=Anatomy_term R5BR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004039;class=Anatomy_term R2BR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003904;class=Anatomy_term ASEL]<br>[http://www.wormbase.org/db/get?name=WBbt:0003993;class=Anatomy_term AFDL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004746;class=Anatomy_term I1L]<br>[http://www.wormbase.org/db/get?name=WBbt:0004016;class=Anatomy_term R6AR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003991;class=Anatomy_term AFDR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003891;class=Anatomy_term ASGR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004014;class=Anatomy_term R6BL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004006;class=Anatomy_term R7AL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004018;class=Anatomy_term R6AL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004012;class=Anatomy_term R6BR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004001;class=Anatomy_term R7BL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004041;class=Anatomy_term R2AR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004023;class=Anatomy_term R5AR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003903;class=Anatomy_term ASER]<br>[http://www.wormbase.org/db/get?name=WBbt:0004745;class=Anatomy_term I1R]<br>[http://www.wormbase.org/db/get?name=WBbt:0004022;class=Anatomy_term R5BL] | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00024197;class=Paper WBPaper00024197] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=ynIs67;class=Transgene ynIs67] | + | | [http://www.wormbase.org/db/get?name=ynIs67;class=Transgene ynIs67] |
+ | | [flp-6::gfp] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=NY2067;class=Strain NY2067] | ||
+ | | III | ||
+ | | [http://www.wormbase.org/db/get?name=Expr3031;class=Expr_pattern Expr3031] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00001449;class=Gene flp-6] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0004000;class=Anatomy_term R7BR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004040;class=Anatomy_term R2BL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004021;class=Anatomy_term R5BR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004039;class=Anatomy_term R2BR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004014;class=Anatomy_term R6BL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004012;class=Anatomy_term R6BR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004001;class=Anatomy_term R7BL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004022;class=Anatomy_term R5BL] | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00006506;class=Paper WBPaper00006506] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=ynIs79;class=Transgene ynIs79] | + | | [http://www.wormbase.org/db/get?name=ynIs79;class=Transgene ynIs79] |
+ | | [apl-1::APL-1-GFP] | ||
+ | | GFP | ||
+ | | | ||
+ | | V | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=ynIs82;class=Transgene ynIs82] | + | | [http://www.wormbase.org/db/get?name=ynIs82;class=Transgene ynIs82] |
+ | | [flp-12::gfp] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=NY2082;class=Strain NY2082] | ||
+ | | III | ||
+ | | [http://www.wormbase.org/db/get?name=Expr3013;class=Expr_pattern Expr3013] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00001455;class=Gene flp-12] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0004029;class=Anatomy_term R4AR]<br>[http://www.wormbase.org/db/get?name=WBbt:0005001;class=Anatomy_term SAAVR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004000;class=Anatomy_term R7BR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004024;class=Anatomy_term R5AL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004027;class=Anatomy_term R4BR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004072;class=Anatomy_term PVR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004030;class=Anatomy_term R4AL]<br>[http://www.wormbase.org/db/get?name=WBbt:0005003;class=Anatomy_term SAAVL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004386;class=Anatomy_term PDA]<br>[http://www.wormbase.org/db/get?name=WBbt:0003847;class=Anatomy_term AVJL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004002;class=Anatomy_term R7AR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004052;class=Anatomy_term R1AL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004975;class=Anatomy_term SMBDR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004021;class=Anatomy_term R5BR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003812;class=Anatomy_term BDUL]<br>[http://www.wormbase.org/db/get?name=WBbt:0003824;class=Anatomy_term BAGL]<br>[http://www.wormbase.org/db/get?name=WBbt:0005007;class=Anatomy_term SAADL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004887;class=Anatomy_term CP9]<br>[http://www.wormbase.org/db/get?name=WBbt:0004028;class=Anatomy_term R4BL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004046;class=Anatomy_term R1BR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003849;class=Anatomy_term AVHL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004993;class=Anatomy_term SDQL]<br>[http://www.wormbase.org/db/get?name=WBbt:0005005;class=Anatomy_term SAADR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004050;class=Anatomy_term R1AR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004973;class=Anatomy_term SMBVR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004991;class=Anatomy_term SDQR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004006;class=Anatomy_term R7AL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004974;class=Anatomy_term SMBVL]<br>[http://www.wormbase.org/db/get?name=WBbt:0003848;class=Anatomy_term AVHR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004001;class=Anatomy_term R7BL]<br>[http://www.wormbase.org/db/get?name=WBbt:0003846;class=Anatomy_term AVJR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003811;class=Anatomy_term BDUR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004976;class=Anatomy_term SMBDL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004023;class=Anatomy_term R5AR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003823;class=Anatomy_term BAGR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004022;class=Anatomy_term R5BL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004048;class=Anatomy_term R1BL] | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00024197;class=Paper WBPaper00024197] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=ynIs86;class=Transgene ynIs86] | + | | [http://www.wormbase.org/db/get?name=ynIs86;class=Transgene ynIs86] |
+ | | [apl-1(+)] | ||
+ | | | ||
+ | | | ||
+ | | X | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=ysIs42;class=Transgene ysIs42] | + | | [http://www.wormbase.org/db/get?name=ysIs42;class=Transgene ysIs42] |
+ | | [punc-4::snb-1::GFP; lin-15+] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=NM670;class=Strain NM670] | ||
+ | | X | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=yzIs71;class=Transgene yzIs71] | + | | [http://www.wormbase.org/db/get?name=yzIs71;class=Transgene yzIs71] |
+ | | [tph-1::gfp; rol-6(d)] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=GR1333;class=Strain GR1333] | ||
+ | | V | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=zIs356;class=Transgene zIs356] | + | | [http://www.wormbase.org/db/get?name=zIs356;class=Transgene zIs356] |
+ | | [daf-16::daf-16-gfp; rol-6] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=TJ356;class=Strain TJ356] | ||
+ | | IV | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=zcIs13;class=Transgene zcIs13] | + | | [http://www.wormbase.org/db/get?name=zcIs13;class=Transgene zcIs13] |
+ | | [hsp-6::gfp] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=SJ4100;class=Strain SJ4100] | ||
+ | | V | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=zcIs19;class=Transgene zcIs19] | + | | [http://www.wormbase.org/db/get?name=zcIs19;class=Transgene zcIs19] |
+ | | [ubl-5::gfp] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=SJ4151;class=Strain SJ4151] | ||
+ | | X | ||
+ | | [http://www.wormbase.org/db/get?name=Expr4516;class=Expr_pattern Expr4516] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00006726;class=Gene ubl-5] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0005772;class=Anatomy_term intestine]<br>[http://www.wormbase.org/db/get?name=WBbt:0003681;class=Anatomy_term pharynx] | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00027723;class=Paper WBPaper00027723] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=zcIs22;class=Transgene zcIs22] | + | | [http://www.wormbase.org/db/get?name=zcIs22;class=Transgene zcIs22] |
+ | | [ubl-5Cb::gfp] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=SJ4153;class=Strain SJ4153] | ||
+ | | I | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=zcIs39;class=Transgene zcIs39] | + | | [http://www.wormbase.org/db/get?name=zcIs39;class=Transgene zcIs39] |
+ | | [dve-1::dve-1-gfp] translational fusion expressing DVE-1 fused to GFP at its C-terminal residue 468. | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=SJ4197;class=Strain SJ4197] | ||
+ | | II | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=zcIs4;class=Transgene zcIs4] | + | | [http://www.wormbase.org/db/get?name=zcIs4;class=Transgene zcIs4] |
+ | | [hsp-4::gfp] translational fusion with 1.1 kb of genomic DNA immediately 5' upstream of ATG amplified by PCR and ligated in-frame with GFP in pPD95.75. | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=SJ6;class=Strain SJ6]<br>[http://www.wormbase.org/db/get?name=SJ17;class=Strain SJ17]<br>[http://www.wormbase.org/db/get?name=SJ30;class=Strain SJ30]<br>[http://www.wormbase.org/db/get?name=SJ4005;class=Strain SJ4005] | ||
+ | | V | ||
+ | | [http://www.wormbase.org/db/get?name=Expr3927;class=Expr_pattern Expr3927] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00002008;class=Gene hsp-4] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0005772;class=Anatomy_term intestine] | ||
+ | | [http://www.wormbase.org/db/get?name=L1%20larva;class=Life_stage L1 larva]<br>[http://www.wormbase.org/db/get?name=L2%20larva;class=Life_stage L2 larva]<br>[http://www.wormbase.org/db/get?name=L3%20larva;class=Life_stage L3 larva]<br>[http://www.wormbase.org/db/get?name=L4%20larva;class=Life_stage L4 larva]<br>[http://www.wormbase.org/db/get?name=adult;class=Life_stage adult] | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00027660;class=Paper WBPaper00027660] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=zcIs4;class=Transgene zcIs4] | + | | [http://www.wormbase.org/db/get?name=zcIs4;class=Transgene zcIs4] |
+ | | [hsp-4::gfp] translational fusion with 1.1 kb of genomic DNA immediately 5' upstream of ATG amplified by PCR and ligated in-frame with GFP in pPD95.75. | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=SJ6;class=Strain SJ6]<br>[http://www.wormbase.org/db/get?name=SJ17;class=Strain SJ17]<br>[http://www.wormbase.org/db/get?name=SJ30;class=Strain SJ30]<br>[http://www.wormbase.org/db/get?name=SJ4005;class=Strain SJ4005] | ||
+ | | V | ||
+ | | [http://www.wormbase.org/db/get?name=Expr3928;class=Expr_pattern Expr3928] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00019629;class=Gene cid-1] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0005772;class=Anatomy_term intestine] | ||
+ | | [http://www.wormbase.org/db/get?name=L1%20larva;class=Life_stage L1 larva]<br>[http://www.wormbase.org/db/get?name=L2%20larva;class=Life_stage L2 larva]<br>[http://www.wormbase.org/db/get?name=L3%20larva;class=Life_stage L3 larva]<br>[http://www.wormbase.org/db/get?name=L4%20larva;class=Life_stage L4 larva]<br>[http://www.wormbase.org/db/get?name=adult;class=Life_stage adult] | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00027660;class=Paper WBPaper00027660] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=zcIs40;class=Transgene zcIs40] | + | | [http://www.wormbase.org/db/get?name=zcIs40;class=Transgene zcIs40] |
+ | | [dve-1::dve-1-Myc3-His6, myo-3::gfp] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=SJ4199;class=Strain SJ4199] | ||
+ | | X | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=zcIs8;class=Transgene zcIs8] | + | | [http://www.wormbase.org/db/get?name=zcIs8;class=Transgene zcIs8] |
+ | | [abu-1::gfp] translational fusion. The promoter and coding region of abu-1 was ligated in frame with GFP to produce abu1::abu-1::gfp(ZcEx8) strain. A 1.3-kb fragment of C. elegans genomic DNA immediately 5' of the predicted initiation ATG codon of abu-1 (AC3.3) was amplified by PCR using the oligonucleotides AC3.1S (5' -GGCATTGTGGCACGCATTGAACTG-3') and AC3Bam.2AS (5'-GATAGGATCCATTGTTAATATGCTTGAAGAGCTGC-3') and ligated in frame with the GFP coding region in the plasmid of pPD95.75. The abu-1::gfp(zcEx8) strain was created by coinjecting the ac3.3.pPD95.75 plasmid (25 ug/ml) with a lin-15 rescuing plasmid, pSK1 (25 ug/ml), into lin-15(n765ts) strain. The extrachromosomal array was integrated into the chromosome with ultraviolet/trimethylpsoraren treatment, yielding the abu-1::gfp(zcIs8)X reporter strain. | ||
+ | | GFP | ||
+ | | | ||
+ | | X | ||
+ | | [http://www.wormbase.org/db/get?name=Expr2206;class=Expr_pattern Expr2206] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00000024;class=Gene abu-1] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0003681;class=Anatomy_term pharynx] | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00005432;class=Paper WBPaper00005432] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=zcIs9;class=Transgene zcIs9] | + | | [http://www.wormbase.org/db/get?name=zcIs9;class=Transgene zcIs9] |
+ | | [hsp-60::gfp] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=SJ4058;class=Strain SJ4058] | ||
+ | | V | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=zdIs1;class=Transgene zdIs1] | + | | [http://www.wormbase.org/db/get?name=zdIs1;class=Transgene zdIs1] |
+ | | [ceh-23::GFP, lin-15(+)] | ||
+ | | GFP | ||
+ | | | ||
+ | | IV | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=zdIs10;class=Transgene zdIs10] | + | | [http://www.wormbase.org/db/get?name=zdIs10;class=Transgene zdIs10] |
+ | | [odr-2::cfp] | ||
+ | | CFP | ||
+ | | [http://www.wormbase.org/db/get?name=MT4010;class=Strain MT4010] | ||
+ | | V | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=zdIs13;class=Transgene zdIs13] | + | | [http://www.wormbase.org/db/get?name=zdIs13;class=Transgene zdIs13] |
+ | | [tph-1::gfp] transcriptional fusion. | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=OH4127;class=Strain OH4127]<br>[http://www.wormbase.org/db/get?name=OH4134;class=Strain OH4134]<br>[http://www.wormbase.org/db/get?name=OH4135;class=Strain OH4135]<br>[http://www.wormbase.org/db/get?name=OH4138;class=Strain OH4138]<br>[http://www.wormbase.org/db/get?name=OH4143;class=Strain OH4143]<br>[http://www.wormbase.org/db/get?name=OH4144;class=Strain OH4144]<br>[http://www.wormbase.org/db/get?name=OH4147;class=Strain OH4147]<br>[http://www.wormbase.org/db/get?name=MT4013;class=Strain MT4013] | ||
+ | | IV | ||
+ | | [http://www.wormbase.org/db/get?name=Expr8142;class=Expr_pattern Expr8142] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00006600;class=Gene tph-1] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0004757;class=Anatomy_term HSNR]<br>[http://www.wormbase.org/db/get?name=WBbt:0005451;class=Anatomy_term pharyngeal muscle cell]<br>[http://www.wormbase.org/db/get?name=WBbt:0004003;class=Anatomy_term ADFL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004446;class=Anatomy_term NSMR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003999;class=Anatomy_term ADFR]<br>[http://www.wormbase.org/db/get?name=WBbt:0006749;class=Anatomy_term nerve ring]<br>[http://www.wormbase.org/db/get?name=WBbt:0004758;class=Anatomy_term HSNL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004457;class=Anatomy_term NSML] | ||
+ | | [http://www.wormbase.org/db/get?name=elongating%20embryo;class=Life_stage elongating embryo]<br>[http://www.wormbase.org/db/get?name=fully-elongated%20embryo;class=Life_stage fully-elongated embryo]<br>[http://www.wormbase.org/db/get?name=L1%20larva;class=Life_stage L1 larva]<br>[http://www.wormbase.org/db/get?name=L2%20larva;class=Life_stage L2 larva]<br>[http://www.wormbase.org/db/get?name=L3%20larva;class=Life_stage L3 larva]<br>[http://www.wormbase.org/db/get?name=L4%20larva;class=Life_stage L4 larva]<br>[http://www.wormbase.org/db/get?name=adult;class=Life_stage adult] | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00031671;class=Paper WBPaper00031671] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=zdIs15;class=Transgene zdIs15] | + | | [http://www.wormbase.org/db/get?name=zdIs15;class=Transgene zdIs15] |
+ | | [lsm-6::gfp; lin-15(+)] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=MT4015;class=Strain MT4015] | ||
+ | | V | ||
+ | | [http://www.wormbase.org/db/get?name=Expr2638;class=Expr_pattern Expr2638] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00003080;class=Gene lsm-6] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0005821;class=Anatomy_term vulval muscle]<br>[http://www.wormbase.org/db/get?name=WBbt:0005828;class=Anatomy_term gonadal sheath cell]<br>[http://www.wormbase.org/db/get?name=WBbt:0005813;class=Anatomy_term body wall musculature]<br>[http://www.wormbase.org/db/get?name=WBbt:0005342;class=Anatomy_term uterine muscle]<br>[http://www.wormbase.org/db/get?name=WBbt:0004506;class=Anatomy_term gon_herm_dtc_P]<br>[http://www.wormbase.org/db/get?name=WBbt:0004520;class=Anatomy_term gon_herm_dtc_A] | ||
+ | | [http://www.wormbase.org/db/get?name=adult%20hermaphrodite;class=Life_stage adult hermaphrodite] | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00006281;class=Paper WBPaper00006281] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=zdIs21;class=Transgene zdIs21] | + | | [http://www.wormbase.org/db/get?name=zdIs21;class=Transgene zdIs21] |
+ | | [zag-1::gfp] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=OH4141;class=Strain OH4141]<br>[http://www.wormbase.org/db/get?name=MT4021;class=Strain MT4021] | ||
+ | | IV | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=zdIs3;class=Transgene zdIs3] | + | | [http://www.wormbase.org/db/get?name=zdIs3;class=Transgene zdIs3] |
+ | | [glr-1::gfp] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=MT4003;class=Strain MT4003] | ||
+ | | IV | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=zdIs31;class=Transgene zdIs31] | + | | [http://www.wormbase.org/db/get?name=zdIs31;class=Transgene zdIs31] |
+ | | [dat-1::gfp] | ||
+ | | GFP | ||
+ | | | ||
+ | | X | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=zdIs4;class=Transgene zdIs4] | + | | [http://www.wormbase.org/db/get?name=zdIs4;class=Transgene zdIs4] |
+ | | [mec-4::gfp, lin-15(+)] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=SK4005;class=Strain SK4005] | ||
+ | | IV | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=zdIs42;class=Transgene zdIs42] | + | | [http://www.wormbase.org/db/get?name=zdIs42;class=Transgene zdIs42] |
+ | | [unc-129::gfp] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=MT4042;class=Strain MT4042] | ||
+ | | IV | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=zdIs45;class=Transgene zdIs45] | + | | [http://www.wormbase.org/db/get?name=zdIs45;class=Transgene zdIs45] |
+ | | [mgl-2::gfp] | ||
+ | | GFP | ||
+ | | | ||
+ | | II | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=zdIs5;class=Transgene zdIs5] | + | | [http://www.wormbase.org/db/get?name=zdIs5;class=Transgene zdIs5] |
+ | | [mec-4::GFP] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=IC136;class=Strain IC136]<br>[http://www.wormbase.org/db/get?name=IC156;class=Strain IC156]<br>[http://www.wormbase.org/db/get?name=IC400;class=Strain IC400]<br>[http://www.wormbase.org/db/get?name=NG4370;class=Strain NG4370]<br>[http://www.wormbase.org/db/get?name=SK4005;class=Strain SK4005]<br>[http://www.wormbase.org/db/get?name=TL24;class=Strain TL24]<br>[http://www.wormbase.org/db/get?name=ZB154;class=Strain ZB154]<br>[http://www.wormbase.org/db/get?name=MT4005;class=Strain MT4005] | ||
+ | | I | ||
+ | | [http://www.wormbase.org/db/get?name=Marker71;class=Expr_pattern Marker71] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00003168;class=Gene mec-4] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0003832;class=Anatomy_term AVM] | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00031651;class=Paper WBPaper00031651] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=zdIs5;class=Transgene zdIs5] | + | | [http://www.wormbase.org/db/get?name=zdIs5;class=Transgene zdIs5] |
+ | | [mec-4::GFP] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=IC136;class=Strain IC136]<br>[http://www.wormbase.org/db/get?name=IC156;class=Strain IC156]<br>[http://www.wormbase.org/db/get?name=IC400;class=Strain IC400]<br>[http://www.wormbase.org/db/get?name=NG4370;class=Strain NG4370]<br>[http://www.wormbase.org/db/get?name=SK4005;class=Strain SK4005]<br>[http://www.wormbase.org/db/get?name=TL24;class=Strain TL24]<br>[http://www.wormbase.org/db/get?name=ZB154;class=Strain ZB154]<br>[http://www.wormbase.org/db/get?name=MT4005;class=Strain MT4005] | ||
+ | | I | ||
+ | | [http://www.wormbase.org/db/get?name=Marker72;class=Expr_pattern Marker72] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00003168;class=Gene mec-4] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0005237;class=Anatomy_term touch receptor neuron] | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00032072;class=Paper WBPaper00032072] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=zfIs1;class=Transgene zfIs1] | + | | [http://www.wormbase.org/db/get?name=zfIs1;class=Transgene zfIs1] |
+ | | [tdc-1::gfp, lin-15(+)] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=QW2;class=Strain QW2] | ||
+ | | I | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=zhIs4;class=Transgene zhIs4] | | + | | [http://www.wormbase.org/db/get?name=zhIs4;class=Transgene zhIs4] |
+ | | | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=AH142;class=Strain AH142] | ||
+ | | III | ||
+ | | [http://www.wormbase.org/db/get?name=Expr801;class=Expr_pattern Expr801] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00003043;class=Gene lip-1] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0006896;class=Anatomy_term P8.p]<br>[http://www.wormbase.org/db/get?name=WBbt:0006891;class=Anatomy_term P3.p]<br>[http://www.wormbase.org/db/get?name=WBbt:0006893;class=Anatomy_term P5.p]<br>[http://www.wormbase.org/db/get?name=WBbt:0006894;class=Anatomy_term P6.p]<br>[http://www.wormbase.org/db/get?name=WBbt:0006895;class=Anatomy_term P7.p]<br>[http://www.wormbase.org/db/get?name=WBbt:0005734;class=Anatomy_term hyp7 syncytium]<br>[http://www.wormbase.org/db/get?name=WBbt:0006892;class=Anatomy_term P4.p] | ||
+ | | [http://www.wormbase.org/db/get?name=all%20stages;class=Life_stage all stages] | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00004542;class=Paper WBPaper00004542] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=zuIs6;class=Transgene zuIs6] | + | | [http://www.wormbase.org/db/get?name=zuIs6;class=Transgene zuIs6] |
+ | | [end-1::actin-gfp, unc-119(+)] | ||
+ | | GFP | ||
+ | | | ||
+ | | X | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|} | |} |
Revision as of 23:10, 29 September 2008
WormBase Release WS195
408 integrated transgenes with map information found (download Excel file)