Difference between revisions of "Mapped Transgenes"
From WormBaseWiki
Jump to navigationJump to searchLine 1: | Line 1: | ||
− | === WormBase Release | + | === WormBase Release WS193 === |
− | + | 393 integrated transgenes with map information found ([[Media:Mapped_transgenes.xls|download Excel file]]) | |
{| width="" cellspacing="0" cellpadding="10" border="1" | {| width="" cellspacing="0" cellpadding="10" border="1" | ||
Line 74: | Line 74: | ||
| [pmyo-3::ssGFP] | | [pmyo-3::ssGFP] | ||
| GFP | | GFP | ||
− | | [http://www.wormbase.org/db/get?name=GS1912;class=Strain GS1912]<br>[http://www.wormbase.org/db/get?name=GS2477;class=Strain GS2477]<br>[http://www.wormbase.org/db/get?name=GS2478;class=Strain GS2478]<br>[http://www.wormbase.org/db/get?name=GS2479;class=Strain GS2479]<br>[http://www.wormbase.org/db/get?name=GS2484;class=Strain GS2484]<br>[http://www.wormbase.org/db/get?name=GS2495;class=Strain GS2495]<br>[http://www.wormbase.org/db/get?name=GS2526;class=Strain GS2526]<br>[http://www.wormbase.org/db/get?name=GS2527;class=Strain GS2527]<br>[http://www.wormbase.org/db/get?name=GS2532;class=Strain GS2532]<br>[http://www.wormbase.org/db/get?name=GS2555;class=Strain GS2555]<br>[http://www.wormbase.org/db/get?name=GS2643;class=Strain GS2643]<br>[http://www.wormbase.org/db/get?name=LW557;class=Strain LW557]<br>[http://www.wormbase.org/db/get?name=LW614;class=Strain LW614]<br>[http://www.wormbase.org/db/get?name=LW1288;class=Strain LW1288 | + | | [http://www.wormbase.org/db/get?name=GS1919;class=Strain GS1919]<br>[http://www.wormbase.org/db/get?name=GS1912;class=Strain GS1912]<br>[http://www.wormbase.org/db/get?name=GS2477;class=Strain GS2477]<br>[http://www.wormbase.org/db/get?name=GS2478;class=Strain GS2478]<br>[http://www.wormbase.org/db/get?name=GS2479;class=Strain GS2479]<br>[http://www.wormbase.org/db/get?name=GS2484;class=Strain GS2484]<br>[http://www.wormbase.org/db/get?name=GS2495;class=Strain GS2495]<br>[http://www.wormbase.org/db/get?name=GS2526;class=Strain GS2526]<br>[http://www.wormbase.org/db/get?name=GS2527;class=Strain GS2527]<br>[http://www.wormbase.org/db/get?name=GS2532;class=Strain GS2532]<br>[http://www.wormbase.org/db/get?name=GS2555;class=Strain GS2555]<br>[http://www.wormbase.org/db/get?name=GS2643;class=Strain GS2643]<br>[http://www.wormbase.org/db/get?name=LW557;class=Strain LW557]<br>[http://www.wormbase.org/db/get?name=LW614;class=Strain LW614]<br>[http://www.wormbase.org/db/get?name=LW1288;class=Strain LW1288] |
| I | | I | ||
| | | | ||
Line 85: | Line 85: | ||
| [myo-3::secreted gfp] | | [myo-3::secreted gfp] | ||
| GFP | | GFP | ||
− | | [http://www.wormbase.org/db/get?name= | + | | [http://www.wormbase.org/db/get?name=GS2077;class=Strain GS2077]<br>[http://www.wormbase.org/db/get?name=PD3011;class=Strain PD3011] |
| X | | X | ||
| | | | ||
Line 153: | Line 153: | ||
| | | | ||
| IV | | IV | ||
+ | | [http://www.wormbase.org/db/get?name=Expr8096;class=Expr_pattern Expr8096] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00001184;class=Gene egl-15] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0005733;class=Anatomy_term hypodermis] | ||
| | | | ||
− | | | + | | [http://www.wormbase.org/db/get?name=WBPaper00031854;class=Paper WBPaper00031854] |
− | |||
− | |||
− | |||
|- | |- | ||
| [http://www.wormbase.org/db/get?name=ayIs4;class=Transgene ayIs4] | | [http://www.wormbase.org/db/get?name=ayIs4;class=Transgene ayIs4] | ||
Line 197: | Line 197: | ||
| [http://www.wormbase.org/db/get?name=PD4666;class=Strain PD4666] | | [http://www.wormbase.org/db/get?name=PD4666;class=Strain PD4666] | ||
| X | | X | ||
+ | | [http://www.wormbase.org/db/get?name=Expr8096;class=Expr_pattern Expr8096] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00001184;class=Gene egl-15] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0005733;class=Anatomy_term hypodermis] | ||
| | | | ||
− | | | + | | [http://www.wormbase.org/db/get?name=WBPaper00031854;class=Paper WBPaper00031854] |
− | |||
− | |||
− | |||
|- | |- | ||
| [http://www.wormbase.org/db/get?name=ayIs7;class=Transgene ayIs7] | | [http://www.wormbase.org/db/get?name=ayIs7;class=Transgene ayIs7] | ||
Line 228: | Line 228: | ||
| [vit-2::gfp; rol-6(su1006)]. The plasmid V2B3 encodes a functional VIT-2(YP170B)::GFP fusion protein expressed under vit-2 promoter control. The plasmid was made by ligating a PCR product encoding vit-2 genomic sequences, including 1 kb of promoter and the complete gene lacking a stop codon, into the GFP plasmid pPD95.85, cut with XmaI and KpnI. The vit-2 gene was PCR amplified with primers V2F (TCCCCCCGGGTCCACGGACATTTCTGGGTCATTTG) and V2R (CGGGGTACCAGATAAGCGACGCAGGCGGTTGGGAC), containing engineered XmaI and KpnI sites, using cosmid DNA (C42D8) as a template. V2B3, at 50 ug/ml, was coinjected with rol-6(d) marker pRF4, at 100 ug/ml, into N2 to make transformed lines using standard methods. Four integrated lines (bIs1bIs4) were produced by standard methods. | | [vit-2::gfp; rol-6(su1006)]. The plasmid V2B3 encodes a functional VIT-2(YP170B)::GFP fusion protein expressed under vit-2 promoter control. The plasmid was made by ligating a PCR product encoding vit-2 genomic sequences, including 1 kb of promoter and the complete gene lacking a stop codon, into the GFP plasmid pPD95.85, cut with XmaI and KpnI. The vit-2 gene was PCR amplified with primers V2F (TCCCCCCGGGTCCACGGACATTTCTGGGTCATTTG) and V2R (CGGGGTACCAGATAAGCGACGCAGGCGGTTGGGAC), containing engineered XmaI and KpnI sites, using cosmid DNA (C42D8) as a template. V2B3, at 50 ug/ml, was coinjected with rol-6(d) marker pRF4, at 100 ug/ml, into N2 to make transformed lines using standard methods. Four integrated lines (bIs1bIs4) were produced by standard methods. | ||
| GFP | | GFP | ||
− | | [http://www.wormbase.org/db/get?name= | + | | [http://www.wormbase.org/db/get?name=DH1006;class=Strain DH1006]<br>[http://www.wormbase.org/db/get?name=DH1033;class=Strain DH1033] |
| X | | X | ||
| | | | ||
Line 305: | Line 305: | ||
| [pie-1::gfp-pgl-1, unc-119(+)]. Constructed by amplification of a 2.2 kb segment of pgl-1 cDNA with the primers 5'-GGACTAGTATGGAGGCTAACAAGCG-3' and 5'-CCACTAGTTTAGAAACCTCCGCGTCC-3', digestion of the PCR product and the plasmid pAZ132 with SpeI, ligation of the pgl-1 product and the SpeI fragment of pAZ132 bearing unc-119(+) and pie-1::gfp sequences, and bombardment of the ligated DNA into unc-119(ed3) worms. | | [pie-1::gfp-pgl-1, unc-119(+)]. Constructed by amplification of a 2.2 kb segment of pgl-1 cDNA with the primers 5'-GGACTAGTATGGAGGCTAACAAGCG-3' and 5'-CCACTAGTTTAGAAACCTCCGCGTCC-3', digestion of the PCR product and the plasmid pAZ132 with SpeI, ligation of the pgl-1 product and the SpeI fragment of pAZ132 bearing unc-119(+) and pie-1::gfp sequences, and bombardment of the ligated DNA into unc-119(ed3) worms. | ||
| GFP | | GFP | ||
− | | [http://www.wormbase.org/db/get?name= | + | | [http://www.wormbase.org/db/get?name=SS629;class=Strain SS629]<br>[http://www.wormbase.org/db/get?name=SS747;class=Strain SS747] |
| I | | I | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | |- | ||
+ | | [http://www.wormbase.org/db/get?name=bpIs56;class=Transgene bpIs56] | ||
+ | | [alg-1::dsRed] | ||
+ | | DsRed | ||
+ | | | ||
+ | | II | ||
| | | | ||
| | | | ||
Line 371: | Line 382: | ||
| [myo-3::Ngfp-lacZ; myo-3::Mtgfp] | | [myo-3::Ngfp-lacZ; myo-3::Mtgfp] | ||
| GFP | | GFP | ||
− | | [http://www.wormbase.org/db/get?name= | + | | [http://www.wormbase.org/db/get?name=PD4251;class=Strain PD4251]<br>[http://www.wormbase.org/db/get?name=PD6249;class=Strain PD6249]<br>[http://www.wormbase.org/db/get?name=CB5600;class=Strain CB5600]<br>[http://www.wormbase.org/db/get?name=HC75;class=Strain HC75]<br>[http://www.wormbase.org/db/get?name=HC114;class=Strain HC114]<br>[http://www.wormbase.org/db/get?name=HC271;class=Strain HC271] |
| I:4 | | I:4 | ||
| | | | ||
Line 470: | Line 481: | ||
| [lmn-1::gfp]. A fusion of GFP to the C-terminus of Ce-lamin. | | [lmn-1::gfp]. A fusion of GFP to the C-terminus of Ce-lamin. | ||
| GFP | | GFP | ||
− | | [http://www.wormbase.org/db/get?name= | + | | [http://www.wormbase.org/db/get?name=LW0697;class=Strain LW0697]<br>[http://www.wormbase.org/db/get?name=YG1021;class=Strain YG1021] |
| X | | X | ||
| [http://www.wormbase.org/db/get?name=Expr956;class=Expr_pattern Expr956] | | [http://www.wormbase.org/db/get?name=Expr956;class=Expr_pattern Expr956] | ||
Line 679: | Line 690: | ||
| [myo-2 C183::gfp]. Integrated expression line for myo-2 enhancer C subelement C183::gfp. | | [myo-2 C183::gfp]. Integrated expression line for myo-2 enhancer C subelement C183::gfp. | ||
| GFP | | GFP | ||
− | | [http://www.wormbase.org/db/get?name=OK0039;class=Strain OK0039] | + | | [http://www.wormbase.org/db/get?name=OK0039;class=Strain OK0039]<br>[http://www.wormbase.org/db/get?name=OK39;class=Strain OK39]<br>[http://www.wormbase.org/db/get?name=OK66;class=Strain OK66]<br>[http://www.wormbase.org/db/get?name=OK68;class=Strain OK68] |
| IV | | IV | ||
| | | | ||
Line 736: | Line 747: | ||
| [http://www.wormbase.org/db/get?name=CL2166;class=Strain CL2166] | | [http://www.wormbase.org/db/get?name=CL2166;class=Strain CL2166] | ||
| III | | III | ||
+ | | [http://www.wormbase.org/db/get?name=Expr8083;class=Expr_pattern Expr8083] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00001752;class=Gene gst-4] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0005813;class=Anatomy_term body wall musculature] | ||
| | | | ||
− | | | + | | [http://www.wormbase.org/db/get?name=WBPaper00031223;class=Paper WBPaper00031223] |
− | |||
− | |||
− | |||
|- | |- | ||
| [http://www.wormbase.org/db/get?name=eIs24;class=Transgene eIs24] | | [http://www.wormbase.org/db/get?name=eIs24;class=Transgene eIs24] | ||
Line 835: | Line 846: | ||
| | | | ||
| X | | X | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | |- | ||
+ | | [http://www.wormbase.org/db/get?name=etIs1;class=Transgene etIs1] | ||
+ | | [ric-19::gfp] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=QC5;class=Strain QC5] | ||
+ | | IV | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | |- | ||
+ | | [http://www.wormbase.org/db/get?name=etIs2;class=Transgene etIs2] | ||
+ | | [ric-19::gfp] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=QC47;class=Strain QC47]<br>[http://www.wormbase.org/db/get?name=QC101;class=Strain QC101]<br>[http://www.wormbase.org/db/get?name=QC102;class=Strain QC102]<br>[http://www.wormbase.org/db/get?name=QC103;class=Strain QC103]<br>[http://www.wormbase.org/db/get?name=QC104;class=Strain QC104]<br>[http://www.wormbase.org/db/get?name=QC105;class=Strain QC105] | ||
+ | | III | ||
| | | | ||
| | | | ||
Line 874: | Line 907: | ||
| | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=evIs99;class=Transgene evIs99] | + | | [http://www.wormbase.org/db/get?name=evIs98;class=Transgene evIs98] |
− | | [emb-9::unc-5; emb-9::lacZ; dpy-20(+)] | + | | [unc-5::GFP; dpy-20(+)] |
− | | LacZ | + | | GFP |
+ | | | ||
+ | | V | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | |- | ||
+ | | [http://www.wormbase.org/db/get?name=evIs99;class=Transgene evIs99] | ||
+ | | [emb-9::unc-5; emb-9::lacZ; dpy-20(+)] | ||
+ | | LacZ | ||
| | | | ||
| I | | I | ||
Line 1,042: | Line 1,086: | ||
| [unc-129::CFP, glr-1::YFP, unc-47::DsRed, hsp-16::rol-6] | | [unc-129::CFP, glr-1::YFP, unc-47::DsRed, hsp-16::rol-6] | ||
| CFP, YFP, DsRed | | CFP, YFP, DsRed | ||
− | | [http://www.wormbase.org/db/get?name= | + | | [http://www.wormbase.org/db/get?name=VH318;class=Strain VH318]<br>[http://www.wormbase.org/db/get?name=VH715;class=Strain VH715] |
| V | | V | ||
| | | | ||
Line 1,119: | Line 1,163: | ||
| [ida-1::gfp] translational fusion, which contains a 2443 bp ida-1 promoter upstream of an ida-1 coding region that incorporates introns 3-9 followed at the 3'-end with in-frame GFP coding sequence and terminating with the unc-54 3'-untranslated region. | | [ida-1::gfp] translational fusion, which contains a 2443 bp ida-1 promoter upstream of an ida-1 coding region that incorporates introns 3-9 followed at the 3'-end with in-frame GFP coding sequence and terminating with the unc-54 3'-untranslated region. | ||
| GFP | | GFP | ||
− | | [http://www.wormbase.org/db/get?name= | + | | [http://www.wormbase.org/db/get?name=BL5750;class=Strain BL5750]<br>[http://www.wormbase.org/db/get?name=BL5752;class=Strain BL5752] |
| IV | | IV | ||
| [http://www.wormbase.org/db/get?name=Expr2970;class=Expr_pattern Expr2970] | | [http://www.wormbase.org/db/get?name=Expr2970;class=Expr_pattern Expr2970] | ||
Line 1,130: | Line 1,174: | ||
| [ida-1::gfp] translational fusion, which contains a 2443 bp ida-1 promoter upstream of an ida-1 coding region that incorporates introns 3-9 followed at the 3'-end with in-frame GFP coding sequence and terminating with the unc-54 3'-untranslated region. | | [ida-1::gfp] translational fusion, which contains a 2443 bp ida-1 promoter upstream of an ida-1 coding region that incorporates introns 3-9 followed at the 3'-end with in-frame GFP coding sequence and terminating with the unc-54 3'-untranslated region. | ||
| GFP | | GFP | ||
− | | [http://www.wormbase.org/db/get?name= | + | | [http://www.wormbase.org/db/get?name=BL5751;class=Strain BL5751]<br>[http://www.wormbase.org/db/get?name=BL5752;class=Strain BL5752] |
| I | | I | ||
| [http://www.wormbase.org/db/get?name=Expr2970;class=Expr_pattern Expr2970] | | [http://www.wormbase.org/db/get?name=Expr2970;class=Expr_pattern Expr2970] | ||
Line 1,141: | Line 1,185: | ||
| [elt-2::YFP] | | [elt-2::YFP] | ||
| YFP | | YFP | ||
+ | | | ||
+ | | V | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | |- | ||
+ | | [http://www.wormbase.org/db/get?name=irIs25;class=Transgene irIs25] | ||
+ | | [elt-2::GFP] | ||
+ | | GFP | ||
| | | | ||
| V | | V | ||
Line 1,163: | Line 1,218: | ||
| [ajm-1::gfp; unc-29(+); rol-6(su1006)] | | [ajm-1::gfp; unc-29(+); rol-6(su1006)] | ||
| GFP | | GFP | ||
− | | [http://www.wormbase.org/db/get?name= | + | | [http://www.wormbase.org/db/get?name=SU93;class=Strain SU93]<br>[http://www.wormbase.org/db/get?name=DF67;class=Strain DF67]<br>[http://www.wormbase.org/db/get?name=BP76;class=Strain BP76]<br>[http://www.wormbase.org/db/get?name=BR2958;class=Strain BR2958]<br>[http://www.wormbase.org/db/get?name=NW1615;class=Strain NW1615]<br>[http://www.wormbase.org/db/get?name=NW1702;class=Strain NW1702]<br>[http://www.wormbase.org/db/get?name=NW1704;class=Strain NW1704]<br>[http://www.wormbase.org/db/get?name=OH4129;class=Strain OH4129]<br>[http://www.wormbase.org/db/get?name=SU180;class=Strain SU180]<br>[http://www.wormbase.org/db/get?name=WH171;class=Strain WH171] |
| IV | | IV | ||
| [http://www.wormbase.org/db/get?name=Expr1682;class=Expr_pattern Expr1682] | | [http://www.wormbase.org/db/get?name=Expr1682;class=Expr_pattern Expr1682] | ||
Line 1,187: | Line 1,242: | ||
| [http://www.wormbase.org/db/get?name=LW0709;class=Strain LW0709] | | [http://www.wormbase.org/db/get?name=LW0709;class=Strain LW0709] | ||
| I | | I | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | |- | ||
+ | | [http://www.wormbase.org/db/get?name=jjIs64;class=Transgene jjIs64] | ||
+ | | [arg-1::gfp] | ||
+ | | GFP | ||
+ | | | ||
+ | | V | ||
| | | | ||
| | | | ||
Line 1,198: | Line 1,264: | ||
| [http://www.wormbase.org/db/get?name=NM664;class=Strain NM664]<br>[http://www.wormbase.org/db/get?name=NM1448;class=Strain NM1448]<br>[http://www.wormbase.org/db/get?name=NM1455;class=Strain NM1455]<br>[http://www.wormbase.org/db/get?name=NM1489;class=Strain NM1489]<br>[http://www.wormbase.org/db/get?name=NM2040;class=Strain NM2040] | | [http://www.wormbase.org/db/get?name=NM664;class=Strain NM664]<br>[http://www.wormbase.org/db/get?name=NM1448;class=Strain NM1448]<br>[http://www.wormbase.org/db/get?name=NM1455;class=Strain NM1455]<br>[http://www.wormbase.org/db/get?name=NM1489;class=Strain NM1489]<br>[http://www.wormbase.org/db/get?name=NM2040;class=Strain NM2040] | ||
| V | | V | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | |- | ||
+ | | [http://www.wormbase.org/db/get?name=jsIs40;class=Transgene jsIs40] | ||
+ | | [mec-7::snb-1-gfp] | ||
+ | | GFP | ||
+ | | | ||
+ | | I | ||
| | | | ||
| | | | ||
Line 1,218: | Line 1,295: | ||
| [unc-25::gfp] | | [unc-25::gfp] | ||
| GFP | | GFP | ||
− | | [http://www.wormbase.org/db/get?name= | + | | [http://www.wormbase.org/db/get?name=CZ1197;class=Strain CZ1197]<br>[http://www.wormbase.org/db/get?name=IC700;class=Strain IC700] |
| III | | III | ||
| | | | ||
Line 1,229: | Line 1,306: | ||
| [unc-25::gfp] | | [unc-25::gfp] | ||
| GFP | | GFP | ||
− | | [http://www.wormbase.org/db/get?name= | + | | [http://www.wormbase.org/db/get?name=CZ1200;class=Strain CZ1200]<br>[http://www.wormbase.org/db/get?name=CZ1758;class=Strain CZ1758]<br>[http://www.wormbase.org/db/get?name=CZ1632;class=Strain CZ1632]<br>[http://www.wormbase.org/db/get?name=CZ1931;class=Strain CZ1931]<br>[http://www.wormbase.org/db/get?name=CZ1935;class=Strain CZ1935]<br>[http://www.wormbase.org/db/get?name=OH4121;class=Strain OH4121]<br>[http://www.wormbase.org/db/get?name=OH4128;class=Strain OH4128] |
| II | | II | ||
| | | | ||
Line 1,361: | Line 1,438: | ||
| str-2::gfp | | str-2::gfp | ||
| GFP | | GFP | ||
− | | [http://www.wormbase.org/db/get?name= | + | | [http://www.wormbase.org/db/get?name=CX3933;class=Strain CX3933]<br>[http://www.wormbase.org/db/get?name=CX4828;class=Strain CX4828]<br>[http://www.wormbase.org/db/get?name=CX4998;class=Strain CX4998]<br>[http://www.wormbase.org/db/get?name=PY1133;class=Strain PY1133]<br>[http://www.wormbase.org/db/get?name=CX3695;class=Strain CX3695]<br>[http://www.wormbase.org/db/get?name=LG313;class=Strain LG313]<br>[http://www.wormbase.org/db/get?name=CX3940;class=Strain CX3940]<br>[http://www.wormbase.org/db/get?name=CX5757;class=Strain CX5757]<br>[http://www.wormbase.org/db/get?name=CX5893;class=Strain CX5893]<br>[http://www.wormbase.org/db/get?name=CX5922;class=Strain CX5922]<br>[http://www.wormbase.org/db/get?name=OH4768;class=Strain OH4768] |
| I | | I | ||
| [http://www.wormbase.org/db/get?name=Expr1165;class=Expr_pattern Expr1165] | | [http://www.wormbase.org/db/get?name=Expr1165;class=Expr_pattern Expr1165] | ||
Line 1,534: | Line 1,611: | ||
| | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=kyIs37;class=Transgene kyIs37] | + | | [http://www.wormbase.org/db/get?name=kyIs323;class=Transgene kyIs323] |
− | | [odr-10::gfp]. With the odr-10 promoter and the first 6 amino acids of ODR-10 fused to GFP. | + | | [str-2::GFP, unc-122::GFP] |
+ | | GFP | ||
+ | | | ||
+ | | II | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | |- | ||
+ | | [http://www.wormbase.org/db/get?name=kyIs37;class=Transgene kyIs37] | ||
+ | | [odr-10::gfp]. With the odr-10 promoter and the first 6 amino acids of ODR-10 fused to GFP. | ||
| GFP | | GFP | ||
| [http://www.wormbase.org/db/get?name=CX3260;class=Strain CX3260] | | [http://www.wormbase.org/db/get?name=CX3260;class=Strain CX3260] | ||
Line 1,559: | Line 1,647: | ||
| [sra-6::gfp] | | [sra-6::gfp] | ||
| GFP | | GFP | ||
− | | [http://www.wormbase.org/db/get?name= | + | | [http://www.wormbase.org/db/get?name=CX3350;class=Strain CX3350]<br>[http://www.wormbase.org/db/get?name=CX3465;class=Strain CX3465] |
| I | | I | ||
| [http://www.wormbase.org/db/get?name=Expr296;class=Expr_pattern Expr296] | | [http://www.wormbase.org/db/get?name=Expr296;class=Expr_pattern Expr296] | ||
Line 1,570: | Line 1,658: | ||
| [ceh-23-unc-76-gfp::lin-15] | | [ceh-23-unc-76-gfp::lin-15] | ||
| | | | ||
− | | [http://www.wormbase.org/db/get?name=CX188;class=Strain CX188]<br>[http://www.wormbase.org/db/get?name= | + | | [http://www.wormbase.org/db/get?name=CX188;class=Strain CX188]<br>[http://www.wormbase.org/db/get?name=CX2627;class=Strain CX2627]<br>[http://www.wormbase.org/db/get?name=CX2993;class=Strain CX2993]<br>[http://www.wormbase.org/db/get?name=CX3125;class=Strain CX3125]<br>[http://www.wormbase.org/db/get?name=CX3137;class=Strain CX3137]<br>[http://www.wormbase.org/db/get?name=CX2565;class=Strain CX2565] |
| X | | X | ||
| | | | ||
Line 1,581: | Line 1,669: | ||
| [ceh-23-unc-76-gfp::lin-15] | | [ceh-23-unc-76-gfp::lin-15] | ||
| | | | ||
− | | [http://www.wormbase.org/db/get?name= | + | | [http://www.wormbase.org/db/get?name=CX2644;class=Strain CX2644]<br>[http://www.wormbase.org/db/get?name=NG2501;class=Strain NG2501] |
| IV | | IV | ||
| | | | ||
Line 1,638: | Line 1,726: | ||
| | | | ||
| IV | | IV | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | |- | ||
+ | | [http://www.wormbase.org/db/get?name=ltIs44;class=Transgene ltIs44] | ||
+ | | [pie-1::PHdomain-mCherry] | ||
+ | | mCherry | ||
+ | | [http://www.wormbase.org/db/get?name=DG2160;class=Strain DG2160]<br>[http://www.wormbase.org/db/get?name=DG2189;class=Strain DG2189] | ||
+ | | V | ||
| | | | ||
| | | | ||
Line 1,647: | Line 1,746: | ||
| [act-4::LacZ] | | [act-4::LacZ] | ||
| LacZ | | LacZ | ||
− | | [http://www.wormbase.org/db/get?name= | + | | [http://www.wormbase.org/db/get?name=EH16;class=Strain EH16]<br>[http://www.wormbase.org/db/get?name=PJ1077;class=Strain PJ1077] |
| X | | X | ||
| | | | ||
Line 1,669: | Line 1,768: | ||
| [myo-2::gfp] | | [myo-2::gfp] | ||
| GFP | | GFP | ||
− | | [http://www.wormbase.org/db/get?name= | + | | [http://www.wormbase.org/db/get?name=PD4792;class=Strain PD4792]<br>[http://www.wormbase.org/db/get?name=CA538;class=Strain CA538]<br>[http://www.wormbase.org/db/get?name=HC114;class=Strain HC114]<br>[http://www.wormbase.org/db/get?name=HC271;class=Strain HC271]<br>[http://www.wormbase.org/db/get?name=VC49;class=Strain VC49]<br>[http://www.wormbase.org/db/get?name=VC177;class=Strain VC177]<br>[http://www.wormbase.org/db/get?name=VC485;class=Strain VC485] |
| IV:5 | | IV:5 | ||
| | | | ||
Line 1,702: | Line 1,801: | ||
| [myo-2::gfp; pes-10::gfp] containing the myo-2 and pes-10 promoters and a gut enhancer fused individually to the GFP. | | [myo-2::gfp; pes-10::gfp] containing the myo-2 and pes-10 promoters and a gut enhancer fused individually to the GFP. | ||
| GFP | | GFP | ||
− | | [http://www.wormbase.org/db/get?name= | + | | [http://www.wormbase.org/db/get?name=DR2078;class=Strain DR2078]<br>[http://www.wormbase.org/db/get?name=VC354;class=Strain VC354]<br>[http://www.wormbase.org/db/get?name=VC114;class=Strain VC114]<br>[http://www.wormbase.org/db/get?name=VC42;class=Strain VC42]<br>[http://www.wormbase.org/db/get?name=AD226;class=Strain AD226]<br>[http://www.wormbase.org/db/get?name=BP601;class=Strain BP601]<br>[http://www.wormbase.org/db/get?name=BP610;class=Strain BP610]<br>[http://www.wormbase.org/db/get?name=BS3493;class=Strain BS3493]<br>[http://www.wormbase.org/db/get?name=DG1612;class=Strain DG1612]<br>[http://www.wormbase.org/db/get?name=DG1650;class=Strain DG1650]<br>[http://www.wormbase.org/db/get?name=DZ205;class=Strain DZ205]<br>[http://www.wormbase.org/db/get?name=DZ240;class=Strain DZ240]<br>[http://www.wormbase.org/db/get?name=GC565;class=Strain GC565]<br>[http://www.wormbase.org/db/get?name=HS458;class=Strain HS458]<br>[http://www.wormbase.org/db/get?name=IC361;class=Strain IC361]<br>[http://www.wormbase.org/db/get?name=JK3107;class=Strain JK3107]<br>[http://www.wormbase.org/db/get?name=JK3172;class=Strain JK3172]<br>[http://www.wormbase.org/db/get?name=JK3182;class=Strain JK3182]<br>[http://www.wormbase.org/db/get?name=JK3345;class=Strain JK3345]<br>[http://www.wormbase.org/db/get?name=JK3375;class=Strain JK3375]<br>[http://www.wormbase.org/db/get?name=JN214;class=Strain JN214]<br>[http://www.wormbase.org/db/get?name=LB21;class=Strain LB21]<br>[http://www.wormbase.org/db/get?name=ML1213;class=Strain ML1213]<br>[http://www.wormbase.org/db/get?name=MT12352;class=Strain MT12352]<br>[http://www.wormbase.org/db/get?name=NG3124;class=Strain NG3124]<br>[http://www.wormbase.org/db/get?name=NG3190;class=Strain NG3190]<br>[http://www.wormbase.org/db/get?name=PS4886;class=Strain PS4886]<br>[http://www.wormbase.org/db/get?name=PS5131;class=Strain PS5131]<br>[http://www.wormbase.org/db/get?name=SA25;class=Strain SA25]<br>[http://www.wormbase.org/db/get?name=SL740;class=Strain SL740]<br>[http://www.wormbase.org/db/get?name=SL940;class=Strain SL940]<br>[http://www.wormbase.org/db/get?name=SL978;class=Strain SL978]<br>[http://www.wormbase.org/db/get?name=SU351;class=Strain SU351]<br>[http://www.wormbase.org/db/get?name=SU352;class=Strain SU352]<br>[http://www.wormbase.org/db/get?name=VC28;class=Strain VC28]<br>[http://www.wormbase.org/db/get?name=VC170;class=Strain VC170]<br>[http://www.wormbase.org/db/get?name=VC185;class=Strain VC185]<br>[http://www.wormbase.org/db/get?name=VC206;class=Strain VC206]<br>[http://www.wormbase.org/db/get?name=VC277;class=Strain VC277]<br>[http://www.wormbase.org/db/get?name=VC294;class=Strain VC294]<br>[http://www.wormbase.org/db/get?name=VC308;class=Strain VC308]<br>[http://www.wormbase.org/db/get?name=VC337;class=Strain VC337]<br>[http://www.wormbase.org/db/get?name=VC363;class=Strain VC363]<br>[http://www.wormbase.org/db/get?name=VC368;class=Strain VC368]<br>[http://www.wormbase.org/db/get?name=VC384;class=Strain VC384]<br>[http://www.wormbase.org/db/get?name=VC389;class=Strain VC389]<br>[http://www.wormbase.org/db/get?name=VC407;class=Strain VC407]<br>[http://www.wormbase.org/db/get?name=VC455;class=Strain VC455]<br>[http://www.wormbase.org/db/get?name=VC465;class=Strain VC465]<br>[http://www.wormbase.org/db/get?name=VC515;class=Strain VC515]<br>[http://www.wormbase.org/db/get?name=VC516;class=Strain VC516]<br>[http://www.wormbase.org/db/get?name=VC536;class=Strain VC536]<br>[http://www.wormbase.org/db/get?name=VC559;class=Strain VC559]<br>[http://www.wormbase.org/db/get?name=VC570;class=Strain VC570]<br>[http://www.wormbase.org/db/get?name=VC572;class=Strain VC572]<br>[http://www.wormbase.org/db/get?name=VC598;class=Strain VC598]<br>[http://www.wormbase.org/db/get?name=VC611;class=Strain VC611]<br>[http://www.wormbase.org/db/get?name=VC663;class=Strain VC663]<br>[http://www.wormbase.org/db/get?name=VC682;class=Strain VC682]<br>[http://www.wormbase.org/db/get?name=VC695;class=Strain VC695]<br>[http://www.wormbase.org/db/get?name=VC703;class=Strain VC703]<br>[http://www.wormbase.org/db/get?name=VC704;class=Strain VC704]<br>[http://www.wormbase.org/db/get?name=VC715;class=Strain VC715]<br>[http://www.wormbase.org/db/get?name=VC724;class=Strain VC724]<br>[http://www.wormbase.org/db/get?name=VC735;class=Strain VC735]<br>[http://www.wormbase.org/db/get?name=VC774;class=Strain VC774]<br>[http://www.wormbase.org/db/get?name=VC777;class=Strain VC777]<br>[http://www.wormbase.org/db/get?name=VC778;class=Strain VC778]<br>[http://www.wormbase.org/db/get?name=VC789;class=Strain VC789]<br>[http://www.wormbase.org/db/get?name=VC842;class=Strain VC842]<br>[http://www.wormbase.org/db/get?name=VC895;class=Strain VC895]<br>[http://www.wormbase.org/db/get?name=VC898;class=Strain VC898]<br>[http://www.wormbase.org/db/get?name=VC902;class=Strain VC902]<br>[http://www.wormbase.org/db/get?name=VC926;class=Strain VC926]<br>[http://www.wormbase.org/db/get?name=VC946;class=Strain VC946]<br>[http://www.wormbase.org/db/get?name=VC965;class=Strain VC965]<br>[http://www.wormbase.org/db/get?name=VC984;class=Strain VC984]<br>[http://www.wormbase.org/db/get?name=VC1016;class=Strain VC1016]<br>[http://www.wormbase.org/db/get?name=VC1033;class=Strain VC1033]<br>[http://www.wormbase.org/db/get?name=VC1049;class=Strain VC1049]<br>[http://www.wormbase.org/db/get?name=VC1082;class=Strain VC1082]<br>[http://www.wormbase.org/db/get?name=VC1112;class=Strain VC1112]<br>[http://www.wormbase.org/db/get?name=VC1123;class=Strain VC1123]<br>[http://www.wormbase.org/db/get?name=VC1135;class=Strain VC1135]<br>[http://www.wormbase.org/db/get?name=VC1158;class=Strain VC1158]<br>[http://www.wormbase.org/db/get?name=VC1165;class=Strain VC1165]<br>[http://www.wormbase.org/db/get?name=VC1274;class=Strain VC1274]<br>[http://www.wormbase.org/db/get?name=VC1275;class=Strain VC1275]<br>[http://www.wormbase.org/db/get?name=VC1300;class=Strain VC1300]<br>[http://www.wormbase.org/db/get?name=VC1330;class=Strain VC1330]<br>[http://www.wormbase.org/db/get?name=VC1333;class=Strain VC1333]<br>[http://www.wormbase.org/db/get?name=VC1336;class=Strain VC1336]<br>[http://www.wormbase.org/db/get?name=VC1345;class=Strain VC1345]<br>[http://www.wormbase.org/db/get?name=VC1368;class=Strain VC1368]<br>[http://www.wormbase.org/db/get?name=VC1401;class=Strain VC1401]<br>[http://www.wormbase.org/db/get?name=VC1424;class=Strain VC1424]<br>[http://www.wormbase.org/db/get?name=VC1426;class=Strain VC1426]<br>[http://www.wormbase.org/db/get?name=VC1438;class=Strain VC1438]<br>[http://www.wormbase.org/db/get?name=VC1458;class=Strain VC1458]<br>[http://www.wormbase.org/db/get?name=VC1474;class=Strain VC1474]<br>[http://www.wormbase.org/db/get?name=VC1498;class=Strain VC1498]<br>[http://www.wormbase.org/db/get?name=VC1505;class=Strain VC1505]<br>[http://www.wormbase.org/db/get?name=VC1506;class=Strain VC1506]<br>[http://www.wormbase.org/db/get?name=VC1636;class=Strain VC1636]<br>[http://www.wormbase.org/db/get?name=VC1710;class=Strain VC1710]<br>[http://www.wormbase.org/db/get?name=VC1781;class=Strain VC1781]<br>[http://www.wormbase.org/db/get?name=VC1783;class=Strain VC1783]<br>[http://www.wormbase.org/db/get?name=VC1790;class=Strain VC1790]<br>[http://www.wormbase.org/db/get?name=VC1832;class=Strain VC1832]<br>[http://www.wormbase.org/db/get?name=VC1834;class=Strain VC1834]<br>[http://www.wormbase.org/db/get?name=VC1887;class=Strain VC1887]<br>[http://www.wormbase.org/db/get?name=VC1888;class=Strain VC1888]<br>[http://www.wormbase.org/db/get?name=VC1914;class=Strain VC1914]<br>[http://www.wormbase.org/db/get?name=VC1998;class=Strain VC1998]<br>[http://www.wormbase.org/db/get?name=VC2013;class=Strain VC2013]<br>[http://www.wormbase.org/db/get?name=VC10002;class=Strain VC10002]<br>[http://www.wormbase.org/db/get?name=VC10005;class=Strain VC10005]<br>[http://www.wormbase.org/db/get?name=VC10007;class=Strain VC10007] |
| II | | II | ||
| | | | ||
Line 1,724: | Line 1,823: | ||
| [rnr::gfp] | | [rnr::gfp] | ||
| GFP | | GFP | ||
− | | [http://www.wormbase.org/db/get?name= | + | | [http://www.wormbase.org/db/get?name=VT765;class=Strain VT765]<br>[http://www.wormbase.org/db/get?name=SV273;class=Strain SV273]<br>[http://www.wormbase.org/db/get?name=SV275;class=Strain SV275]<br>[http://www.wormbase.org/db/get?name=SV411;class=Strain SV411]<br>[http://www.wormbase.org/db/get?name=VT774;class=Strain VT774] |
| X | | X | ||
| | | | ||
Line 1,845: | Line 1,944: | ||
| [daf-16::gfp::daf-16; odr-1::rfp] | | [daf-16::gfp::daf-16; odr-1::rfp] | ||
| GFP | | GFP | ||
− | | | + | | [http://www.wormbase.org/db/get?name=CF1935;class=Strain CF1935]<br>[http://www.wormbase.org/db/get?name=CF2135;class=Strain CF2135] |
| X | | X | ||
| | | | ||
Line 1,878: | Line 1,977: | ||
| [mab-5::lacZ; unc-31(+)], contained 7 kb upstream of mab-5 and the first 17 amino acids of coding sequence. Transgenic markers: Unc-31 | | [mab-5::lacZ; unc-31(+)], contained 7 kb upstream of mab-5 and the first 17 amino acids of coding sequence. Transgenic markers: Unc-31 | ||
| LacZ | | LacZ | ||
− | | [http://www.wormbase.org/db/get?name= | + | | [http://www.wormbase.org/db/get?name=CF186;class=Strain CF186]<br>[http://www.wormbase.org/db/get?name=CF180;class=Strain CF180]<br>[http://www.wormbase.org/db/get?name=CF190;class=Strain CF190]<br>[http://www.wormbase.org/db/get?name=CF182;class=Strain CF182]<br>[http://www.wormbase.org/db/get?name=CF237;class=Strain CF237] |
| IV | | IV | ||
| [http://www.wormbase.org/db/get?name=Expr585;class=Expr_pattern Expr585] | | [http://www.wormbase.org/db/get?name=Expr585;class=Expr_pattern Expr585] | ||
Line 1,911: | Line 2,010: | ||
| [mec-7::gfp; lin-15(+)] | | [mec-7::gfp; lin-15(+)] | ||
| GFP | | GFP | ||
− | | [http://www.wormbase.org/db/get?name= | + | | [http://www.wormbase.org/db/get?name=CF703;class=Strain CF703]<br>[http://www.wormbase.org/db/get?name=CF1192;class=Strain CF1192]<br>[http://www.wormbase.org/db/get?name=CF1632;class=Strain CF1632] |
| V | | V | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | |- | ||
+ | | [http://www.wormbase.org/db/get?name=muIs4;class=Transgene muIs4] | ||
+ | | [mab-5::lacZ, rol-6(d)] | ||
+ | | LacZ | ||
+ | | | ||
+ | | I | ||
| | | | ||
| | | | ||
Line 1,999: | Line 2,109: | ||
| [hs::mab-5; C14G10(unc-31+)] | | [hs::mab-5; C14G10(unc-31+)] | ||
| | | | ||
− | | [http://www.wormbase.org/db/get?name= | + | | [http://www.wormbase.org/db/get?name=CF303;class=Strain CF303]<br>[http://www.wormbase.org/db/get?name=CF301;class=Strain CF301] |
| X | | X | ||
| | | | ||
Line 2,161: | Line 2,271: | ||
| | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name= | + | | [http://www.wormbase.org/db/get?name=nsIs105;class=Transgene nsIs105] |
− | | [ | + | | [hlh-17::GFP] |
| GFP | | GFP | ||
| | | | ||
− | | | + | | I |
| | | | ||
| | | | ||
Line 2,172: | Line 2,282: | ||
| | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name= | + | | [http://www.wormbase.org/db/get?name=nsIs136;class=Transgene nsIs136] |
− | | [ | + | | [ptr-10::myrRFP] |
− | | | + | | myrRFP |
− | | | + | | |
− | | | + | | IV |
| | | | ||
| | | | ||
Line 2,183: | Line 2,293: | ||
| | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=nuIs1;class=Transgene nuIs1] | + | | [http://www.wormbase.org/db/get?name=nsIs145;class=Transgene nsIs145] |
+ | | [ttx-1::RFP] | ||
+ | | RFP | ||
+ | | | ||
+ | | V | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | |- | ||
+ | | [http://www.wormbase.org/db/get?name=nsIs25;class=Transgene nsIs25] | ||
+ | | [(cb)ced-3::gfp] | ||
+ | | GFP | ||
+ | | | ||
+ | | X | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | |- | ||
+ | | [http://www.wormbase.org/db/get?name=ntIs1;class=Transgene ntIs1] | ||
+ | | [gcy-5::gfp] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=OH2871;class=Strain OH2871]<br>[http://www.wormbase.org/db/get?name=OH3192;class=Strain OH3192] | ||
+ | | V | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | |- | ||
+ | | [http://www.wormbase.org/db/get?name=nuIs1;class=Transgene nuIs1] | ||
| [glr-1::gfp] | | [glr-1::gfp] | ||
| GFP | | GFP | ||
Line 2,226: | Line 2,369: | ||
| | | | ||
| [http://www.wormbase.org/db/get?name=WBPaper00025002;class=Paper WBPaper00025002] | | [http://www.wormbase.org/db/get?name=WBPaper00025002;class=Paper WBPaper00025002] | ||
+ | |- | ||
+ | | [http://www.wormbase.org/db/get?name=opIs160;class=Transgene opIs160] | ||
+ | | [yfp::ced-6; unc-119(+)] | ||
+ | | YFP | ||
+ | | | ||
+ | | X | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
| [http://www.wormbase.org/db/get?name=opIs64;class=Transgene opIs64] | | [http://www.wormbase.org/db/get?name=opIs64;class=Transgene opIs64] | ||
Line 2,241: | Line 2,395: | ||
| [lim-6::gfp, rol-6(d)] | | [lim-6::gfp, rol-6(d)] | ||
| GFP | | GFP | ||
− | | [http://www.wormbase.org/db/get?name= | + | | [http://www.wormbase.org/db/get?name=OH812;class=Strain OH812]<br>[http://www.wormbase.org/db/get?name=OH707;class=Strain OH707]<br>[http://www.wormbase.org/db/get?name=OH1571;class=Strain OH1571]<br>[http://www.wormbase.org/db/get?name=OH3491;class=Strain OH3491]<br>[http://www.wormbase.org/db/get?name=OH3556;class=Strain OH3556]<br>[http://www.wormbase.org/db/get?name=OH3568;class=Strain OH3568]<br>[http://www.wormbase.org/db/get?name=OH3645;class=Strain OH3645]<br>[http://www.wormbase.org/db/get?name=OH3646;class=Strain OH3646]<br>[http://www.wormbase.org/db/get?name=OH3679;class=Strain OH3679]<br>[http://www.wormbase.org/db/get?name=OH3681;class=Strain OH3681]<br>[http://www.wormbase.org/db/get?name=OH3754;class=Strain OH3754]<br>[http://www.wormbase.org/db/get?name=OH3895;class=Strain OH3895]<br>[http://www.wormbase.org/db/get?name=OH3900;class=Strain OH3900]<br>[http://www.wormbase.org/db/get?name=OH3902;class=Strain OH3902]<br>[http://www.wormbase.org/db/get?name=OH3959;class=Strain OH3959]<br>[http://www.wormbase.org/db/get?name=OH3962;class=Strain OH3962]<br>[http://www.wormbase.org/db/get?name=OH4013;class=Strain OH4013]<br>[http://www.wormbase.org/db/get?name=OH4027;class=Strain OH4027]<br>[http://www.wormbase.org/db/get?name=OH4176;class=Strain OH4176]<br>[http://www.wormbase.org/db/get?name=OH4830;class=Strain OH4830]<br>[http://www.wormbase.org/db/get?name=OH4974;class=Strain OH4974]<br>[http://www.wormbase.org/db/get?name=OH7115;class=Strain OH7115] |
| I | | I | ||
| | | | ||
Line 2,263: | Line 2,417: | ||
| [gcy-7::gfp] | | [gcy-7::gfp] | ||
| GFP | | GFP | ||
− | | [http://www.wormbase.org/db/get?name= | + | | [http://www.wormbase.org/db/get?name=OH811;class=Strain OH811]<br>[http://www.wormbase.org/db/get?name=OH3191;class=Strain OH3191]<br>[http://www.wormbase.org/db/get?name=OH4605;class=Strain OH4605]<br>[http://www.wormbase.org/db/get?name=OH7116;class=Strain OH7116] |
| V | | V | ||
| | | | ||
Line 2,318: | Line 2,472: | ||
| [ttx-3::kal-1] | | [ttx-3::kal-1] | ||
| | | | ||
− | | [http://www.wormbase.org/db/get?name= | + | | [http://www.wormbase.org/db/get?name=NP97;class=Strain NP97]<br>[http://www.wormbase.org/db/get?name=OH910;class=Strain OH910] |
| II | | II | ||
| | | | ||
Line 2,406: | Line 2,560: | ||
| [unc-47::gfp] | | [unc-47::gfp] | ||
| GFP | | GFP | ||
− | | [http://www.wormbase.org/db/get?name=EG1285;class=Strain EG1285]<br>[http://www.wormbase.org/db/get?name= | + | | [http://www.wormbase.org/db/get?name=EG1285;class=Strain EG1285]<br>[http://www.wormbase.org/db/get?name=EG1524;class=Strain EG1524]<br>[http://www.wormbase.org/db/get?name=VH431;class=Strain VH431]<br>[http://www.wormbase.org/db/get?name=VH984;class=Strain VH984]<br>[http://www.wormbase.org/db/get?name=EG1306;class=Strain EG1306]<br>[http://www.wormbase.org/db/get?name=HJ1;class=Strain HJ1]<br>[http://www.wormbase.org/db/get?name=HJ154;class=Strain HJ154]<br>[http://www.wormbase.org/db/get?name=OH775;class=Strain OH775]<br>[http://www.wormbase.org/db/get?name=OH1003;class=Strain OH1003]<br>[http://www.wormbase.org/db/get?name=OH1476;class=Strain OH1476]<br>[http://www.wormbase.org/db/get?name=OH1589;class=Strain OH1589]<br>[http://www.wormbase.org/db/get?name=OH2000;class=Strain OH2000]<br>[http://www.wormbase.org/db/get?name=OH2096;class=Strain OH2096]<br>[http://www.wormbase.org/db/get?name=OH2344;class=Strain OH2344]<br>[http://www.wormbase.org/db/get?name=OH2345;class=Strain OH2345]<br>[http://www.wormbase.org/db/get?name=OH2346;class=Strain OH2346]<br>[http://www.wormbase.org/db/get?name=OH2347;class=Strain OH2347]<br>[http://www.wormbase.org/db/get?name=OH2382;class=Strain OH2382]<br>[http://www.wormbase.org/db/get?name=OH2383;class=Strain OH2383] |
| X | | X | ||
| | | | ||
Line 2,436: | Line 2,590: | ||
| | | | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name= | + | | [http://www.wormbase.org/db/get?name=oxIs30;class=Transgene oxIs30] |
− | | [ | + | | [Mos1 Transposase] |
− | |||
| | | | ||
− | | I | + | | |
+ | | X | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | |- | ||
+ | | [http://www.wormbase.org/db/get?name=oxIs33;class=Transgene oxIs33] | ||
+ | | [unc-64(+); unc-122::gfp] | ||
+ | | GFP | ||
+ | | | ||
+ | | I | ||
| | | | ||
| | | | ||
Line 2,472: | Line 2,637: | ||
| [sra-6::gfp] | | [sra-6::gfp] | ||
| GFP | | GFP | ||
− | | [http://www.wormbase.org/db/get?name= | + | | [http://www.wormbase.org/db/get?name=CX5334;class=Strain CX5334]<br>[http://www.wormbase.org/db/get?name=OH2638;class=Strain OH2638]<br>[http://www.wormbase.org/db/get?name=OH2639;class=Strain OH2639]<br>[http://www.wormbase.org/db/get?name=OH3313;class=Strain OH3313]<br>[http://www.wormbase.org/db/get?name=OH3314;class=Strain OH3314]<br>[http://www.wormbase.org/db/get?name=OH3455;class=Strain OH3455]<br>[http://www.wormbase.org/db/get?name=OH3467;class=Strain OH3467]<br>[http://www.wormbase.org/db/get?name=OH3478;class=Strain OH3478]<br>[http://www.wormbase.org/db/get?name=OH4124;class=Strain OH4124]<br>[http://www.wormbase.org/db/get?name=OH4127;class=Strain OH4127]<br>[http://www.wormbase.org/db/get?name=OH4139;class=Strain OH4139]<br>[http://www.wormbase.org/db/get?name=OH4140;class=Strain OH4140]<br>[http://www.wormbase.org/db/get?name=PY1058;class=Strain PY1058] |
| V | | V | ||
| | | | ||
Line 2,494: | Line 2,659: | ||
| [hsp::gsa-1(Q208L); dpy-20(+)] | | [hsp::gsa-1(Q208L); dpy-20(+)] | ||
| | | | ||
− | | [http://www.wormbase.org/db/get?name=NL545;class=Strain NL545]<br>[http://www.wormbase.org/db/get?name=NL585;class=Strain NL585]<br>[http://www.wormbase.org/db/get?name=NL587;class=Strain NL587]<br>[http://www.wormbase.org/db/get?name= | + | | [http://www.wormbase.org/db/get?name=NL545;class=Strain NL545]<br>[http://www.wormbase.org/db/get?name=NL585;class=Strain NL585]<br>[http://www.wormbase.org/db/get?name=NL587;class=Strain NL587]<br>[http://www.wormbase.org/db/get?name=NL520;class=Strain NL520]<br>[http://www.wormbase.org/db/get?name=NL597;class=Strain NL597]<br>[http://www.wormbase.org/db/get?name=NL1236;class=Strain NL1236]<br>[http://www.wormbase.org/db/get?name=NL1908;class=Strain NL1908]<br>[http://www.wormbase.org/db/get?name=NL1909;class=Strain NL1909]<br>[http://www.wormbase.org/db/get?name=NL1921;class=Strain NL1921]<br>[http://www.wormbase.org/db/get?name=NL1925;class=Strain NL1925]<br>[http://www.wormbase.org/db/get?name=NL1947;class=Strain NL1947]<br>[http://www.wormbase.org/db/get?name=NL3231;class=Strain NL3231] |
| X | | X | ||
| | | | ||
Line 2,527: | Line 2,692: | ||
| An integration of [lag-2::gfp] on Chromosome V. | | An integration of [lag-2::gfp] on Chromosome V. | ||
| GFP | | GFP | ||
− | | [http://www.wormbase.org/db/get?name= | + | | [http://www.wormbase.org/db/get?name=JK2822;class=Strain JK2822]<br>[http://www.wormbase.org/db/get?name=JK2049;class=Strain JK2049]<br>[http://www.wormbase.org/db/get?name=YG1011;class=Strain YG1011] |
| V | | V | ||
| [http://www.wormbase.org/db/get?name=Expr3843;class=Expr_pattern Expr3843] | | [http://www.wormbase.org/db/get?name=Expr3843;class=Expr_pattern Expr3843] | ||
Line 2,626: | Line 2,791: | ||
| [unc-119::gfp] | | [unc-119::gfp] | ||
| GFP | | GFP | ||
− | | [http://www.wormbase.org/db/get?name= | + | | [http://www.wormbase.org/db/get?name=VH41;class=Strain VH41]<br>[http://www.wormbase.org/db/get?name=VH624;class=Strain VH624] |
| V | | V | ||
| | | | ||
Line 2,659: | Line 2,824: | ||
| [glr-1::gfp] | | [glr-1::gfp] | ||
| GFP | | GFP | ||
− | | [http://www.wormbase.org/db/get?name= | + | | [http://www.wormbase.org/db/get?name=IM175;class=Strain IM175]<br>[http://www.wormbase.org/db/get?name=IM202;class=Strain IM202]<br>[http://www.wormbase.org/db/get?name=IM205;class=Strain IM205]<br>[http://www.wormbase.org/db/get?name=IM485;class=Strain IM485]<br>[http://www.wormbase.org/db/get?name=IM206;class=Strain IM206]<br>[http://www.wormbase.org/db/get?name=IM484;class=Strain IM484]<br>[http://www.wormbase.org/db/get?name=IM486;class=Strain IM486]<br>[http://www.wormbase.org/db/get?name=IM487;class=Strain IM487]<br>[http://www.wormbase.org/db/get?name=IM488;class=Strain IM488]<br>[http://www.wormbase.org/db/get?name=IM498;class=Strain IM498]<br>[http://www.wormbase.org/db/get?name=IM499;class=Strain IM499]<br>[http://www.wormbase.org/db/get?name=IM500;class=Strain IM500]<br>[http://www.wormbase.org/db/get?name=IM507;class=Strain IM507]<br>[http://www.wormbase.org/db/get?name=IM508;class=Strain IM508]<br>[http://www.wormbase.org/db/get?name=IM509;class=Strain IM509]<br>[http://www.wormbase.org/db/get?name=IM516;class=Strain IM516]<br>[http://www.wormbase.org/db/get?name=IM517;class=Strain IM517]<br>[http://www.wormbase.org/db/get?name=IM518;class=Strain IM518]<br>[http://www.wormbase.org/db/get?name=IM525;class=Strain IM525]<br>[http://www.wormbase.org/db/get?name=IM526;class=Strain IM526]<br>[http://www.wormbase.org/db/get?name=IM527;class=Strain IM527]<br>[http://www.wormbase.org/db/get?name=IM534;class=Strain IM534]<br>[http://www.wormbase.org/db/get?name=IM535;class=Strain IM535]<br>[http://www.wormbase.org/db/get?name=IM536;class=Strain IM536]<br>[http://www.wormbase.org/db/get?name=IM543;class=Strain IM543]<br>[http://www.wormbase.org/db/get?name=IM203;class=Strain IM203]<br>[http://www.wormbase.org/db/get?name=IM204;class=Strain IM204]<br>[http://www.wormbase.org/db/get?name=IM546;class=Strain IM546]<br>[http://www.wormbase.org/db/get?name=IM549;class=Strain IM549]<br>[http://www.wormbase.org/db/get?name=IM336;class=Strain IM336]<br>[http://www.wormbase.org/db/get?name=VH616;class=Strain VH616]<br>[http://www.wormbase.org/db/get?name=VH15;class=Strain VH15]<br>[http://www.wormbase.org/db/get?name=OH4120;class=Strain OH4120]<br>[http://www.wormbase.org/db/get?name=OH4132;class=Strain OH4132]<br>[http://www.wormbase.org/db/get?name=OH4136;class=Strain OH4136]<br>[http://www.wormbase.org/db/get?name=VH4;class=Strain VH4]<br>[http://www.wormbase.org/db/get?name=VH17;class=Strain VH17]<br>[http://www.wormbase.org/db/get?name=VH1160;class=Strain VH1160] |
| III | | III | ||
| | | | ||
Line 2,780: | Line 2,945: | ||
| [pie-1::GFP-his-11, unc-119(+)] | | [pie-1::GFP-his-11, unc-119(+)] | ||
| GFP | | GFP | ||
− | | [http://www.wormbase.org/db/get?name=AZ212;class=Strain AZ212]<br>[http://www.wormbase.org/db/get?name= | + | | [http://www.wormbase.org/db/get?name=AZ212;class=Strain AZ212]<br>[http://www.wormbase.org/db/get?name=NL3630;class=Strain NL3630]<br>[http://www.wormbase.org/db/get?name=TH32;class=Strain TH32]<br>[http://www.wormbase.org/db/get?name=TH33;class=Strain TH33]<br>[http://www.wormbase.org/db/get?name=NL3847;class=Strain NL3847]<br>[http://www.wormbase.org/db/get?name=OC95;class=Strain OC95]<br>[http://www.wormbase.org/db/get?name=RW10006;class=Strain RW10006]<br>[http://www.wormbase.org/db/get?name=TY3558;class=Strain TY3558]<br>[http://www.wormbase.org/db/get?name=XA3501;class=Strain XA3501] |
| III | | III | ||
| | | | ||
Line 2,985: | Line 3,150: | ||
| [http://www.wormbase.org/db/get?name=adult;class=Life_stage adult] | | [http://www.wormbase.org/db/get?name=adult;class=Life_stage adult] | ||
| [http://www.wormbase.org/db/get?name=WBPaper00013312;class=Paper WBPaper00013312] | | [http://www.wormbase.org/db/get?name=WBPaper00013312;class=Paper WBPaper00013312] | ||
+ | |- | ||
+ | | [http://www.wormbase.org/db/get?name=syIs118;class=Transgene syIs118] | ||
+ | | [fos-1a::YFP-TX] | ||
+ | | YFP | ||
+ | | [http://www.wormbase.org/db/get?name=PS4441;class=Strain PS4441] | ||
+ | | I | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
| [http://www.wormbase.org/db/get?name=syIs12;class=Transgene syIs12] | | [http://www.wormbase.org/db/get?name=syIs12;class=Transgene syIs12] | ||
Line 2,991: | Line 3,167: | ||
| [http://www.wormbase.org/db/get?name=PS2037;class=Strain PS2037] | | [http://www.wormbase.org/db/get?name=PS2037;class=Strain PS2037] | ||
| II | | II | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | |- | ||
+ | | [http://www.wormbase.org/db/get?name=syIs129;class=Transgene syIs129] | ||
+ | | [hemicentin-SP::GFP] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=PS4444;class=Strain PS4444] | ||
+ | | III | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | |- | ||
+ | | [http://www.wormbase.org/db/get?name=syIs137;class=Transgene syIs137] | ||
+ | | [fos-1b::CFP-TX] | ||
+ | | CFP | ||
+ | | [http://www.wormbase.org/db/get?name=PS4558;class=Strain PS4558] | ||
+ | | III | ||
| | | | ||
| | | | ||
Line 3,000: | Line 3,198: | ||
| [hsp16-2::goa-1(Q205L); dpy-20(+)]. Integrated transgenic line of activated Goa under the control of hsp16-2 promoter. | | [hsp16-2::goa-1(Q205L); dpy-20(+)]. Integrated transgenic line of activated Goa under the control of hsp16-2 promoter. | ||
| | | | ||
− | | [http://www.wormbase.org/db/get?name= | + | | [http://www.wormbase.org/db/get?name=PS3351;class=Strain PS3351]<br>[http://www.wormbase.org/db/get?name=PS1681;class=Strain PS1681] |
| IV | | IV | ||
| | | | ||
Line 3,011: | Line 3,209: | ||
| [gpa-1::lacZ; dpy-20(+)] | | [gpa-1::lacZ; dpy-20(+)] | ||
| LacZ | | LacZ | ||
− | | [http://www.wormbase.org/db/get?name= | + | | [http://www.wormbase.org/db/get?name=PS2943;class=Strain PS2943]<br>[http://www.wormbase.org/db/get?name=PS3170;class=Strain PS3170]<br>[http://www.wormbase.org/db/get?name=PS1702;class=Strain PS1702]<br>[http://www.wormbase.org/db/get?name=PS2767;class=Strain PS2767] |
| V | | V | ||
| [http://www.wormbase.org/db/get?name=Expr522;class=Expr_pattern Expr522] | | [http://www.wormbase.org/db/get?name=Expr522;class=Expr_pattern Expr522] | ||
Line 3,099: | Line 3,297: | ||
| [ceh-2::yfp] | | [ceh-2::yfp] | ||
| YFP | | YFP | ||
− | | [http://www.wormbase.org/db/get?name= | + | | [http://www.wormbase.org/db/get?name=PS3505;class=Strain PS3505]<br>[http://www.wormbase.org/db/get?name=PS3528;class=Strain PS3528]<br>[http://www.wormbase.org/db/get?name=PS5419;class=Strain PS5419] |
| X | | X | ||
| [http://www.wormbase.org/db/get?name=Expr2356;class=Expr_pattern Expr2356] | | [http://www.wormbase.org/db/get?name=Expr2356;class=Expr_pattern Expr2356] | ||
Line 3,242: | Line 3,440: | ||
| [lin-11::gfp; unc-119(+)] | | [lin-11::gfp; unc-119(+)] | ||
| GFP | | GFP | ||
− | | [http://www.wormbase.org/db/get?name= | + | | [http://www.wormbase.org/db/get?name=PS3808;class=Strain PS3808]<br>[http://www.wormbase.org/db/get?name=DY164;class=Strain DY164] |
| III | | III | ||
| [http://www.wormbase.org/db/get?name=Expr2574;class=Expr_pattern Expr2574] | | [http://www.wormbase.org/db/get?name=Expr2574;class=Expr_pattern Expr2574] | ||
Line 3,250: | Line 3,448: | ||
| [http://www.wormbase.org/db/get?name=WBPaper00005954;class=Paper WBPaper00005954] | | [http://www.wormbase.org/db/get?name=WBPaper00005954;class=Paper WBPaper00005954] | ||
|- | |- | ||
− | | [http://www.wormbase.org/db/get?name=syIs90;class=Transgene syIs90] | + | | [http://www.wormbase.org/db/get?name=syIs802;class=Transgene syIs802] |
− | | [egl-17::yfp] | + | | [myo-2::GFP] |
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=PS9391;class=Strain PS9391] | ||
+ | | X | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | |- | ||
+ | | [http://www.wormbase.org/db/get?name=syIs803;class=Transgene syIs803] | ||
+ | | [myo-2:gfp, daf-4(+)] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=PS9392;class=Strain PS9392] | ||
+ | | II | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | |- | ||
+ | | [http://www.wormbase.org/db/get?name=syIs804;class=Transgene syIs804] | ||
+ | | [myo-2:gfp, daf-4(+)] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=PS9393;class=Strain PS9393] | ||
+ | | X | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | |- | ||
+ | | [http://www.wormbase.org/db/get?name=syIs807;class=Transgene syIs807] | ||
+ | | [myo-2:gfp, daf-4(+)] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=PS9396;class=Strain PS9396] | ||
+ | | IV | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | |- | ||
+ | | [http://www.wormbase.org/db/get?name=syIs90;class=Transgene syIs90] | ||
+ | | [egl-17::yfp] | ||
| YFP | | YFP | ||
| [http://www.wormbase.org/db/get?name=PS3972;class=Strain PS3972] | | [http://www.wormbase.org/db/get?name=PS3972;class=Strain PS3972] | ||
Line 3,315: | Line 3,557: | ||
| | | | ||
| | | | ||
+ | |- | ||
+ | | [http://www.wormbase.org/db/get?name=tnIs13;class=Transgene tnIs13] | ||
+ | | [pie-1::vab-1::gfp; unc-119(+)] | ||
+ | | GFP | ||
+ | | [http://www.wormbase.org/db/get?name=DG2102;class=Strain DG2102]<br>[http://www.wormbase.org/db/get?name=DG2160;class=Strain DG2160]<br>[http://www.wormbase.org/db/get?name=DG2189;class=Strain DG2189]<br>[http://www.wormbase.org/db/get?name=DG2190;class=Strain DG2190] | ||
+ | | V | ||
+ | | [http://www.wormbase.org/db/get?name=Expr8095;class=Expr_pattern Expr8095] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00006868;class=Gene vab-1] | ||
+ | | | ||
+ | | | ||
+ | | [http://www.wormbase.org/db/get?name=WBPaper00031867;class=Paper WBPaper00031867] | ||
|- | |- | ||
| [http://www.wormbase.org/db/get?name=trIs30;class=Transgene trIs30] | | [http://www.wormbase.org/db/get?name=trIs30;class=Transgene trIs30] | ||
Line 3,414: | Line 3,667: | ||
| [http://www.wormbase.org/db/get?name=adult;class=Life_stage adult] | | [http://www.wormbase.org/db/get?name=adult;class=Life_stage adult] | ||
| [http://www.wormbase.org/db/get?name=WBPaper00003119;class=Paper WBPaper00003119] | | [http://www.wormbase.org/db/get?name=WBPaper00003119;class=Paper WBPaper00003119] | ||
+ | |- | ||
+ | | [http://www.wormbase.org/db/get?name=vsIs108;class=Transgene vsIs108] | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | III | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|- | |- | ||
| [http://www.wormbase.org/db/get?name=wIs54;class=Transgene wIs54] | | [http://www.wormbase.org/db/get?name=wIs54;class=Transgene wIs54] | ||
Line 4,001: | Line 4,265: | ||
| [hsp-4::gfp] translational fusion with 1.1 kb of genomic DNA immediately 5' upstream of ATG amplified by PCR and ligated in-frame with GFP in pPD95.75. | | [hsp-4::gfp] translational fusion with 1.1 kb of genomic DNA immediately 5' upstream of ATG amplified by PCR and ligated in-frame with GFP in pPD95.75. | ||
| GFP | | GFP | ||
− | | [http://www.wormbase.org/db/get?name= | + | | [http://www.wormbase.org/db/get?name=SJ4005;class=Strain SJ4005]<br>[http://www.wormbase.org/db/get?name=SJ6;class=Strain SJ6]<br>[http://www.wormbase.org/db/get?name=SJ17;class=Strain SJ17]<br>[http://www.wormbase.org/db/get?name=SJ30;class=Strain SJ30] |
| V | | V | ||
| [http://www.wormbase.org/db/get?name=Expr3927;class=Expr_pattern Expr3927] | | [http://www.wormbase.org/db/get?name=Expr3927;class=Expr_pattern Expr3927] | ||
Line 4,012: | Line 4,276: | ||
| [hsp-4::gfp] translational fusion with 1.1 kb of genomic DNA immediately 5' upstream of ATG amplified by PCR and ligated in-frame with GFP in pPD95.75. | | [hsp-4::gfp] translational fusion with 1.1 kb of genomic DNA immediately 5' upstream of ATG amplified by PCR and ligated in-frame with GFP in pPD95.75. | ||
| GFP | | GFP | ||
− | | [http://www.wormbase.org/db/get?name= | + | | [http://www.wormbase.org/db/get?name=SJ4005;class=Strain SJ4005]<br>[http://www.wormbase.org/db/get?name=SJ6;class=Strain SJ6]<br>[http://www.wormbase.org/db/get?name=SJ17;class=Strain SJ17]<br>[http://www.wormbase.org/db/get?name=SJ30;class=Strain SJ30] |
| V | | V | ||
| [http://www.wormbase.org/db/get?name=Expr3928;class=Expr_pattern Expr3928] | | [http://www.wormbase.org/db/get?name=Expr3928;class=Expr_pattern Expr3928] | ||
Line 4,078: | Line 4,342: | ||
| [tph-1::gfp] | | [tph-1::gfp] | ||
| GFP | | GFP | ||
− | | [http://www.wormbase.org/db/get?name= | + | | [http://www.wormbase.org/db/get?name=MT4013;class=Strain MT4013]<br>[http://www.wormbase.org/db/get?name=OH4127;class=Strain OH4127]<br>[http://www.wormbase.org/db/get?name=OH4134;class=Strain OH4134]<br>[http://www.wormbase.org/db/get?name=OH4135;class=Strain OH4135]<br>[http://www.wormbase.org/db/get?name=OH4138;class=Strain OH4138]<br>[http://www.wormbase.org/db/get?name=OH4143;class=Strain OH4143]<br>[http://www.wormbase.org/db/get?name=OH4144;class=Strain OH4144]<br>[http://www.wormbase.org/db/get?name=OH4147;class=Strain OH4147] |
| IV | | IV | ||
+ | | [http://www.wormbase.org/db/get?name=Expr8142;class=Expr_pattern Expr8142] | ||
+ | | [http://www.wormbase.org/db/get?name=WBGene00006600;class=Gene tph-1] | ||
+ | | [http://www.wormbase.org/db/get?name=WBbt:0005451;class=Anatomy_term pharyngeal muscle cell]<br>[http://www.wormbase.org/db/get?name=WBbt:0004003;class=Anatomy_term ADFL]<br>[http://www.wormbase.org/db/get?name=WBbt:0004446;class=Anatomy_term NSMR]<br>[http://www.wormbase.org/db/get?name=WBbt:0003999;class=Anatomy_term ADFR]<br>[http://www.wormbase.org/db/get?name=WBbt:0004457;class=Anatomy_term NSML] | ||
| | | | ||
− | | | + | | [http://www.wormbase.org/db/get?name=WBPaper00031671;class=Paper WBPaper00031671] |
− | |||
− | |||
− | |||
|- | |- | ||
| [http://www.wormbase.org/db/get?name=zdIs15;class=Transgene zdIs15] | | [http://www.wormbase.org/db/get?name=zdIs15;class=Transgene zdIs15] | ||
Line 4,100: | Line 4,364: | ||
| [zag-1::gfp] | | [zag-1::gfp] | ||
| GFP | | GFP | ||
− | | [http://www.wormbase.org/db/get?name= | + | | [http://www.wormbase.org/db/get?name=MT4021;class=Strain MT4021]<br>[http://www.wormbase.org/db/get?name=OH4141;class=Strain OH4141] |
| IV | | IV | ||
| | | | ||
Line 4,166: | Line 4,430: | ||
| [mec-4::GFP] | | [mec-4::GFP] | ||
| GFP | | GFP | ||
− | | [http://www.wormbase.org/db/get?name= | + | | [http://www.wormbase.org/db/get?name=ZB154;class=Strain ZB154]<br>[http://www.wormbase.org/db/get?name=MT4005;class=Strain MT4005]<br>[http://www.wormbase.org/db/get?name=SK4005;class=Strain SK4005]<br>[http://www.wormbase.org/db/get?name=IC136;class=Strain IC136]<br>[http://www.wormbase.org/db/get?name=IC156;class=Strain IC156]<br>[http://www.wormbase.org/db/get?name=IC400;class=Strain IC400]<br>[http://www.wormbase.org/db/get?name=NG4370;class=Strain NG4370]<br>[http://www.wormbase.org/db/get?name=TL24;class=Strain TL24] |
| I | | I | ||
| | | | ||
Line 4,184: | Line 4,448: | ||
| [http://www.wormbase.org/db/get?name=all%20stages;class=Life_stage all stages] | | [http://www.wormbase.org/db/get?name=all%20stages;class=Life_stage all stages] | ||
| [http://www.wormbase.org/db/get?name=WBPaper00004542;class=Paper WBPaper00004542] | | [http://www.wormbase.org/db/get?name=WBPaper00004542;class=Paper WBPaper00004542] | ||
+ | |- | ||
+ | | [http://www.wormbase.org/db/get?name=zuIs6;class=Transgene zuIs6] | ||
+ | | [end-1::actin-gfp, unc-119(+)] | ||
+ | | GFP | ||
+ | | | ||
+ | | X | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
+ | | | ||
|} | |} |
Revision as of 22:22, 30 July 2008
WormBase Release WS193
393 integrated transgenes with map information found (download Excel file)