WS179

From WormBaseWiki

Jump to: navigation, search

Contents

Release Notes

 New release of WormBase WS179, Wormpep179 and Wormrna179 Mon Jul 30 12:21:01 BST 2007
 
 
 WS179 was built by [Paul]
 ======================================================================
 
 This directory includes:
 i)   database.WS179.*.tar.gz    -   compressed data for new release
 ii)  models.wrm.WS179           -   the latest database schema (also in above database files)
 iii) CHROMOSOMES/subdir         -   contains 3 files (DNA, GFF & AGP per chromosome)
 iv)  WS179-WS178.dbcomp         -   log file reporting difference from last release
 v)   wormpep179.tar.gz          -   full Wormpep distribution corresponding to WS179
 vi)   wormrna179.tar.gz          -   latest WormRNA release containing non-coding RNA's in the genome
 vii)  confirmed_genes.WS179.gz   -   DNA sequences of all genes confirmed by EST &/or cDNA
 viii) cDNA2orf.WS179.gz           -   Latest set of ORF connections to each cDNA (EST, OST, mRNA)
 ix)   gene_interpolated_map_positions.WS179.gz    - Interpolated map positions for each coding/RNA gene
 x)    clone_interpolated_map_positions.WS179.gz   - Interpolated map positions for each clone
 xi)   best_blastp_hits.WS179.gz  - for each C. elegans WormPep protein, lists Best blastp match to
                             human, fly, yeast, C. briggsae, and SwissProt & TrEMBL proteins.
 xii)  best_blastp_hits_brigprot.WS179.gz   - for each C. briggsae protein, lists Best blastp match to
                                      human, fly, yeast, C. elegans, and SwissProt & TrEMBL proteins.
 xiii) geneIDs.WS179.gz   - list of all current gene identifiers with CGC & molecular names (when known)
 xiv)  PCR_product2gene.WS179.gz   - Mappings between PCR products and overlapping Genes
 
 
 Release notes on the web:
 -------------------------
 http://www.wormbase.org/wiki/index.php/Release_notes
 
 
 
 Genome sequence composition:
 ----------------------------
 
        	WS179       	WS178      	change
 ----------------------------------------------
 a    	32365888	32365888	  +0
 c    	17779857	17779856	  +1
 g    	17756016	17756017	  -1
 t    	32365689	32365689	  +0
 n    	0       	0       	  +0
 -    	0       	0       	  +0
 
 Total	100267450	100267450	  +0
 
 
 Chromosomal Changes:
 --------------------
 
 Chromosome: IV
 16601824 16601823 0   ->   16601824 16601824 1
 
 Chromosome: V
 14444487 14444487 1   ->   14444487 14444486 0
 
 
 Gene data set (Live C.elegans genes 24133)
 ------------------------------------------
 Molecular_info              22426 (92.9%)
 Concise_description          4803 (19.9%)
 Reference                    7211 (29.9%)
 CGC_approved Gene name       9332 (38.7%)
 RNAi_result                 19883 (82.4%)
 Microarray_results          19234 (79.7%)
 SAGE_transcript             18646 (77.3%)
 
 
 
 
 Wormpep data set:
 ----------------------------
 
 There are 20150 CDS in autoace, 23481 when counting 3331 alternate splice forms.
 
 The 23481 sequences contain  base pairs in total.
 
 Modified entries      28
 Deleted entries       0
 New entries           35
 Reappeared entries    1
 
 Net change  +36
 
 
 
 Status of entries: Confidence level of prediction (based on the amount of transcript evidence)
 -------------------------------------------------
 Confirmed              7456 (31.8%)	Every base of every exon has transcription evidence (mRNA, EST etc.)
 Partially_confirmed   11327 (48.2%)	Some, but not all exon bases are covered by transcript evidence
 Predicted              4698 (20.0%)	No transcriptional evidence at all
 
 
 
 Status of entries: Protein Accessions
 -------------------------------------
 UniProtKB/Swiss-Prot accessions   3557 (15.1%)
 UniProtKB/TrEMBL accessions     19641 (83.6%)
 
 
 
 Status of entries: Protein_ID's in EMBL
 ---------------------------------------
 Protein_id            23198 (98.8%)
 
 
 
 Gene <-> CDS,Transcript,Pseudogene connections (cgc-approved)
 ---------------------------------------------
 Entries with CGC-approved Gene name   7697
 
 
 GeneModel correction progress WS178 -> WS179
 -----------------------------------------
 Confirmed introns not in a CDS gene model;
 
 		+---------+--------+
 		| Introns | Change |
 		+---------+--------+
 Cambridge	|   3543  |  3475  |
 St Louis 	|   3556  |  3400  |
 		+---------+--------+
 
 
 Members of known repeat families that overlap predicted exons;
 
 		+---------+--------+
 		| Repeats | Change |
 		+---------+--------+
 Cambridge	|      6  |     0  |
 St Louis 	|      6  |     0  |
 		+---------+--------+
 
 
 
 Synchronisation with GenBank / EMBL:
 ------------------------------------
 
 CHROMOSOME_IV	sequence AL132952
 CHROMOSOME_V	sequence Z72508
 CHROMOSOME_V	sequence Z77659
 CHROMOSOME_X	sequence Z67755
 
 There are no gaps remaining in the genome sequence
 ---------------
 For more info mail help@wormbase.org
 -===================================================================================-
 
 
 
 New Data:
 ---------
 1) There is a new set of GFF files of anomalies which curators may take into account when
    curating gene structure. The existence of one or more of these anomalies near a gene does
    not mean that there is necessarily anything wrong with the existing gene structure.
 
    SUPPLEMENTARY_GFF/CHROMOSOME_*_curation_anomalies.gff
 
 
 
 Genome sequence updates:
 -----------------------
 
    |----------------------------------------------------------------------------|
    | Clone  |    Type   |      Flank           | Change |        Flank          |
    |--------|-----------|----------------------|--------|-----------------------|
    | F23B12 | deletion  | tggcttccaacgtgg      |   G    | atcttctggagatg        |
    | Y51H4A | insertion | caggaccagctggatcacctg|   G    | gcgatcaggacaaccaggatc |
    |----------------------------------------------------------------------------|
 
 New Fixes:
 ----------
 1) WABA has been rerun and standardised for both elegans and briggsae.
 
    Previous WABA datasets contained data from different molecule types, clones vs chromosomes or chromosomes vs scaffolds etc.
    All old cb25 data has been removed as previous releases contained old and new.
 
    We Now have:
    elegans_chromosomes::briggsaeCB3_chromosomes
    briggsaeCB3_chromosomes::elegans_chromosomes.
 
 
 
 Known Problems:
 ---------------
 
 
 Other Changes:
 --------------
 
 Proposed Changes / Forthcoming Data:
 -------------------------------------
 
 1) ~5000 21U RNA genes are going to be in WS180
 
 
 Model Changes:
 ------------------------------------
 
 
 -===================================================================================-
 
 
 Quick installation guide for UNIX/Linux systems
 -----------------------------------------------
 
 1. Create a new directory to contain your copy of WormBase,
 	e.g. /users/yourname/wormbase
 
 2. Unpack and untar all of the database.*.tar.gz files into
 	this directory. You will need approximately 2-3 Gb of disk space.
 
 3. Obtain and install a suitable acedb binary for your system
 	(available from www.acedb.org).
 
 4. Use the acedb 'xace' program to open your database, e.g.
 	type 'xace /users/yourname/wormbase' at the command prompt.
 
 5. See the acedb website for more information about acedb and
 	using xace.
 
 ____________  END _____________
 

Known Problems

WABA

Problem

The WABA data involving chrIII of C.briggsae is missing from the ACeDB database as well as the GFF files.

Fix

A tar file with the missing data is available from the Sanger FTP server.

It contains a patchfile for the ACeDB (chrIII_waba_fix.ace) and the GFF (chrIII_waba_fix.gff).

Personal tools